Unlock instant, AI-driven research and patent intelligence for your innovation.

Staphylococcus aureus enterotoxin B (SEB) immune preparation and its preparation method and use

A technology for staphylococcal intestinal and immune preparations, applied in the directions of botanical equipment and methods, biochemical equipment and methods, and applications, can solve problems such as allergic reactions, aseptic suppuration, granulomas, etc., and achieve great development and utilization value. , the effect of enhancing immunogenicity

Inactive Publication Date: 2014-12-31
张婉茹
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Freund's adjuvant is an oil-containing adjuvant and is currently the most widely used experimental adjuvant. Its advantage is that it has a strong immune enhancement effect, including cellular immunity and humoral immunity. Although this type of adjuvant can improve antibody titer In terms of amplitude and immune persistence, it is far superior to aluminum adjuvant, but it has serious adverse reactions. It often causes granuloma and sterile suppuration after injection. The oil stored in the tissue for a long time cannot be metabolized in time, and it is easy to cause allergic reactions. Therefore, this Adjuvants are only used in animal experiments

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Staphylococcus aureus enterotoxin B (SEB) immune preparation and its preparation method and use
  • Staphylococcus aureus enterotoxin B (SEB) immune preparation and its preparation method and use
  • Staphylococcus aureus enterotoxin B (SEB) immune preparation and its preparation method and use

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0040] Example 1: SEB1 gene amplification and pET28a vector connection

[0041] The amino acids of SEB were searched through the protein database and translated into DNA sequences, and amplification primers were designed for it. The upstream primer was marked as P1, and the downstream primer was marked as P2. And NdeI restriction site and EcoRI restriction site were introduced into the N-terminus of SEB1 fragment. Using (SEB full gene sequence SEQ ID NO.1, synthesized by Dalian Bao Biotechnology Co., Ltd.) as template, P1 and P2 as primers for amplification reaction, the obtained PCR product is labeled as SEB1;

[0042] P1 (31bp): 5′CATGCATATGGAAAGCCAGCCGGATCCGAAA 3′ contains NdeI restriction site;

[0043] P2 (23bp): 5′GCGAATTCTCATTTTTTGGTGGTCAGATACACTTC 3′contains an EcoRI restriction site;

[0044] Gene fragments were amplified by conventional methods; analyzed by agarose gel electrophoresis, the results were shown in figure 1 As shown in ., the target gene with a size ...

Embodiment 2

[0046] Embodiment 2: Connection of recombinant plasmid pET28a-SEB2-HSP65

[0047] According to the sequence of the gene, primers with restriction sites at both ends were designed to amplify the target gene; the upstream primer was marked as P3, and the downstream primer was marked as P4; NdeI restriction site and C-terminal were introduced at the N-terminus of SEB EcoRI cleavage site; use (contains the full gene sequence of SEB SEQ ID NO.1, synthesized by Dalian Bao Biotechnology Co., Ltd.) as a template, P3 and P4 as primers for amplification reaction, and the obtained PCR product is labeled as SEB2;

[0048] P3 (34bp): 5′CATGCATATGAGCATTGATCAGTTTCTGTATTTT 3′contains NdeⅠ restriction site;

[0049] P4 (26bp): 5′GCGAATTCATCGCCCGGCGCCGGCAT 3′contains EcoRI restriction site;

[0050] Amplify the gene fragment of SEB2 with conventional PCR method, agarose gel electrophoresis analysis, the result is as follows image 3 As shown in ., the target gene with a size of about 500bp ca...

Embodiment 3

[0056] Embodiment 3: SDS-PAGE result of SEB1 protein and SEB2-HSP65 recombinant protein expression product

[0057] The recombinant plasmids pET28a-SEB1 and pET28a-SEB2-HSP65 were respectively transformed into the expression bacteria-Escherichia coli BL21 (DE3), and after IPTG induced expression, the results of SDS-PAGE showed that the recombinant proteins SEB1 and SEB2-HSP65 were at about 30KD and 80KD respectively. There is an obvious expression band, the size is consistent with the theoretical value; see Figure 6 and 7 ;

[0058] Perform SDS-PAGE electrophoresis at the same time on the supernatant of the SEB1 protein-expressing bacterial lysate and the precipitate. The results show that most of the SEB1 protein is in the supernatant, and there is also a small amount of target protein in the corresponding position in the precipitate, which is considered to be soluble expression. See Figure 6 .

[0059] The SEB2-HSP65 recombinant protein expressing bacteria lysate supern...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides a staphylococcus aureus enterotoxin B (SEB) immune preparation SEB2-HSP65 and its preparation method and use. The preparation method comprises the following steps of modifying a SEB gene into a SEB2 gene, fusing the SEB2 gene and a gene of a heat shock protein HSP65 to obtain a core gene segment SEB2-HSP65, and carrying out expression of the core gene segment SEB2-HSP65 to obtain a recombinant fusion protein SEB2-HSP65. The recombinant protein SEB2 does not have a TCR cell receptor binding capacity thereby solving the problem that the existing SEB immune preparation produces a large amount of inflammatory factors, and the HSP65 enhances immunogenicity of the recombinant fusion protein SEB2. The recombinant fusion protein SEB2-HSP65 as an immune preparation for animal immunization does not need any immunologic adjuvants, can produce high-titer antibodies, can help animals to resist 5*LD50SEB toxin attack and has a protection rate of 100%. The recombinant fusion protein SEB2-HSP65 has large development and use values.

Description

technical field [0001] The invention relates to an immune preparation of Staphylococcus aureus enterotoxin B, a preparation method and application of the medicine. Background technique [0002] Staphylococcus can be divided into Staphylococcus aureus, Staphylococcus epidermidis and Staphylococcus saprophyticus. Food poisoning is mainly caused by enterotoxin produced by Staphylococcus aureus. Staphylococcus aureus is widely present in air, soil, water and objects. The detection rate is also quite high on the body surface of humans and domestic animals and the cavity that communicates with the outside world. The antigenic structure of Staphylococcus is relatively complex. After the cell wall is hydrolyzed, two antigenic components can be obtained by precipitation method, namely protein antigen and polysaccharide antigen. The protein antigen is mainly Staphylococcus protein A (SPA for short), which is a surface antigen. All strains isolated from humans have SPA, and those fr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/31C12N15/62C07K19/00A61K39/085A61P31/04C12R1/445
Inventor 张婉茹张国利张亮朱平田园吴广谋岳玉环
Owner 张婉茹