Glucose oxidase mutant and application thereof

A technology of glucose oxidase and mutants, which is applied in the field of glucose oxidase mutants, can solve the problems of restricting wide application, high production costs, and the ability of glucose oxidase expression to meet industrial production, so as to improve operational performance, internal Tissue texture structure is good, the effect of strengthening muscle strength

Active Publication Date: 2014-08-13
QINGDAO VLAND BIOTECH GRP
View PDF4 Cites 31 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ability of the genetic engineering strains constructed so far to express glucose oxidase cannot meet the requirements of industrial production, resulting in high production costs of the enzyme, which restricts the wide application of the enzyme.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Glucose oxidase mutant and application thereof
  • Glucose oxidase mutant and application thereof
  • Glucose oxidase mutant and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Embodiment 1 Synthesis and amplification of glucose oxidase mutant gene

[0021] In order to improve the heat resistance of glucose oxidase GODP-2 (amino acid sequence: SEQ ID NO: 1) derived from Penicillium decumbens, a large number of mutations of the enzyme were screened by directed evolution technology, and the PCR primer GODP-2 was designed -F, GODP-2-R are as follows:

[0022] GODP-2-F: GGC GAAT TCTACTTGCCAGCACAGCAAATTGATGT (the underline is the restriction endonuclease EcoR I recognition site)

[0023] GODP-2-R: ATA GCGGCCGC TTAAGCAGACTTGGCGTAGTCATCC (the underline is the restriction endonuclease Not I recognition site)

[0024] Using the GODP-2 wild-type gene as a template, the GeneMorph II random mutation PCR kit (Stratagene) was used for PCR amplification with the above primers, and the pET- 21a vector was connected, transformed into E. coli BL21(DE3), spread on LB+Amp plate, and cultured upside down at 37°C. After the transformants appeared, pick them o...

Embodiment 2

[0029] The construction of embodiment 2 Pichia pastoris engineering strain

[0030] The fragment of glucose oxidase GODP-2H cloned above was connected to the expression vector pPIC9K through the EcoRI and NotI sites to construct the expression vector pPIC9K-P2H.

[0031] The expression plasmid pPIC9K-P2H was linearized with SalI, and the linearized fragment was transformed into Pichia pastoris GS115 by electroporation, and the recombinant strain of Pichia pastoris GS115 / pPIC9K-P2H was obtained by screening on the MD plate, and YPD with different concentrations of geneticin Plate screening for high copy transformants.

[0032] One of the transformants was named Pichia pastoris GODP-2H (Pichia pastoris GODP-2H), transferred to BMGY medium, 30°C, 250rpm shaking culture for 1d; then transferred to BMMY medium, 30°C, 250rpm shaking Cultivate; add 0.5% methanol every day to induce expression for 4 days; centrifuge to remove the bacteria to obtain the fermentation supernatant contai...

Embodiment 3

[0034] Embodiment 3 fermentation verification

[0035] Fermentation of Pichia pastoris GODP-2 and Pichia pastoris GODP-2H were carried out in 10L fermenter respectively. The medium formula used for fermentation was: calcium sulfate 1.1g / L, potassium dihydrogen phosphate 5.5g / L, dihydrogen phosphate Ammonium 55g / L, potassium sulfate 20.3g / L, magnesium sulfate 16.4g / L, potassium hydroxide 1.65g / L, defoamer 0.05%.

[0036] Fermentation process: pH value 5.0, temperature 30°C, stirring rate 300rpm, ventilation rate 1.0-1.5 (v / v), dissolved oxygen controlled above 20%.

[0037] The entire fermentation process is divided into three stages: the first stage is the bacterial cell culture stage, the seeds are inserted at a ratio of 7%, and cultured at 30°C for 24-26 hours, marked by the completion of glucose; the second stage is the starvation stage, when the glucose is replenished After that, do not feed any carbon source. When the dissolved oxygen rises above 80%, it means the end of...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a glucose oxidase mutant. According to the glucose oxidase mutant, a 172-nd amino acid of glucose oxidase with an amino acid sequence shown in SEQ ID NO: 1 is changed to Arg from Asn, and a 525-th amino acid of the glucose oxidase is changed to Asn from Cys. The glucose oxidase mutant has an amino acid sequence shown in SEQ ID NO: 3, and a nucleic acid sequence of a coding gene of the glucose oxidase mutant is shown in SEQ ID NO: 4. The glucose oxidase mutant provided by the invention has the optimal action pH value of 6.0, is very stable in the pH range of 4.0-6.0 and has good pH tolerance which is similar to that of a wild type; the optimal action temperature of the mutant is 40 DEG C; residual enzyme activity still can be maintained at 78.1%, 47.7% and 15.9% after the mutant is respectively treated for 1 hour at the temperature of 60 DEG C, 65 DEG C and 70 DEG C; and the heat resistance is far higher than that of the wild type, which means that the heat resistance of the glucose oxidase is greatly improved due to mutation; therefore, the mutant GODP-2H is more suitable for being applied to industrial production compared with the wild type due to the characteristic.

Description

technical field [0001] The invention belongs to the technical field of functional gene modification, and specifically relates to a novel glucose oxidase mutant and its application. Background technique [0002] Glucose oxidase is an aerobic dehydrogenase that specifically oxidizes β-D-glucose to generate gluconic acid and hydrogen peroxide. Glucose oxidase usually forms a redox system with catalase, oxidizes β-D-glucose in the presence of molecular oxygen to generate D-gluconolactone, and consumes oxygen to generate hydrogen peroxide. Catalase decomposes hydrogen peroxide to generate water and 1 / 2 oxygen, and then the water combines with gluconolactone to produce gluconic acid. Glucose oxidase shows strong specificity to β-D-glucopyranose. The hydroxyl group on glucose molecule C1 is crucial to the catalytic activity of the enzyme, and the hydroxyl group at the β position is 160 times higher than that at the α position. Glucose oxidase is completely inactive on L-glucose a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12N15/81C12N1/19A21D8/04C12R1/84C12R1/80
CPCC12N9/0006C12Y101/03004
Inventor付娟肖志壮
OwnerQINGDAO VLAND BIOTECH GRP