Engineering bacteria based on nitrate reductase and implementation method of engineering bacteria

A reductase and nitrate technology is applied in the field of genes and engineering strains in the field of biological genetic engineering technology, which can solve problems such as inconvenience of use, loss of soil nitrogen, secondary pollution, etc., to ensure protein purity, maintain protein activity, The effect of stabilizing biological activity

Inactive Publication Date: 2014-11-12
SHANGHAI JIAO TONG UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although there are many examples of successful application of these methods, there are also many shortcomings: irrigation and salt washing will wash nitrate nitrogen into the ground, which not only causes the loss of soil nitrogen, but also pollutes groundwater; High, easy to produce secondary pollution; the semi-decomposed organic fertilizer method has the disadvantages of slow fertilizer efficiency and inconvenient use
However, the expression level of nitrate reductase in microorganisms is generally very low, and most of them are expressed intracellularly, so the scope and effect of application are very limited and cannot meet the needs of repairing the environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering bacteria based on nitrate reductase and implementation method of engineering bacteria
  • Engineering bacteria based on nitrate reductase and implementation method of engineering bacteria
  • Engineering bacteria based on nitrate reductase and implementation method of engineering bacteria

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027] In this example, Streptomyces griseorubens was isolated from rotten straw collected in Pujiang Town, Shanghai, and its preservation number is CGMCC No.5706. The strain was inoculated in LB liquid medium and cultured at 32°C for 48h.

[0028] The above LB liquid medium components are: peptone 10.0g / L, yeast extract 5.0g / L, NaCl 10.0g / L, pH 6.8-7.2. Add 15.0‐20.0g / L agar to the liquid medium to obtain LB solid medium.

[0029] 1) Genomic DNA extraction of Streptomyces griseorubens: collect 2.0 mL of bacterial liquid, and centrifuge at 12000 rpm for 2 min. Discard the supernatant, collect the bacterial pellet, add 180μL lysozyme (20mg / mL) and 20μL EDTA solution (0.5M, pH8.0), treat at 37℃ for 45min, add 4μL RNase A (100mg / mL), shake and mix for 15s , placed at room temperature for 5 minutes, and then completed the remaining operations according to the instructions of the bacterial DNA extraction kit (TIANGEN) to obtain high-purity genomic DNA. The quality of genomic DNA...

Embodiment 2

[0044] Construction of nitrate reductase expression vector

[0045] 1) According to the sequence of nitrate reductase, design primers containing restriction sites, the sequence is as follows:

[0046] NA‐Nde I‐F: CCATATGGTGGACAGCTCGCCGGACCGCATC

[0047] NA‐EcoR V‐R:CGATATCTCA ATGATGATGATGATGATG TGCCGTGCTCCCCGTCG

[0048] NB‐Nco I‐F:ACCATGGTGACGTCCACGCACTGCCCCTACTGC

[0049] NB‐Hind III‐R:CCAAGCTTTCA ATGATGATGATGATGATG CGGGCGTACCGCCTCC

[0050] 2) Using Streptomyces griseorubens genomic DNA as a template, PCR amplification was performed with primers containing Nco I and Hind III restriction sites to obtain the nitrate reductase electron transfer subunit gene sequence, using DNA A‐Tailing Add A to Kit and connect to T‐Vector PMD TM 19‐T (TaKaRa), and the ligation product was transferred into DH5α E. coli. Positive clones were selected, and plasmids were extracted by shaking bacteria for sequencing. If correct, Nco I and Hind III were subjected to double enzyme digestion ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to engineering bacteria based on nitrate reductase and an implementation method of the engineering bacteria. The method includes the steps of firstly, conducting PCR amplification on primers containing enzyme cutting sites with the streptomyces griseorubens genome DNA as a template to sequentially obtain the nucleotide sequence of encoding nitrate reductase catalysis subunits and the nucleotide sequence of electron transfer subunits; secondly, sequentially connecting the gene sequence obtained through amplification to the co-expression vector pETDuet-1; thirdly, obtaining the recombination co-expression vector pETDuet-NB-NA; fourthly, converting the nitrate reductase expression vector into escherichia coli expression strains. In order to overcome the defects that nitrate reductase is generally endoenzyme in vivo and the expression quantity is low, the application range and the effect are seriously limited, a large amount of nitrate reductase can be expressed and synthesized in vitro through the genetic engineering means. The engineering bacteria and the method have great significance in rapid repair of secondary salinization soil and even the achievement of precision agriculture.

Description

technical field [0001] The invention relates to a gene in the technical field of biogenetic engineering and its engineering strain, in particular to a nitrate reductase-based engineering bacterium of Streptomyces grisea and its realization method. Background technique [0002] With the development of facility agriculture and the continuous expansion of greenhouse cultivation areas, the use of nitrogen fertilizers has increased significantly, greatly exceeding the demand of plants. Because the excess nitrate in the soil was not absorbed and transformed by plants in time, a large amount of salt ions accumulated in the soil, and eventually secondary salinization of the facility carrier soil was formed. [0003] Studies have shown that HCO removal in protected cultivation secondary salinized soil 3 - Outside, Na + 、K + , Ca 2+ , Mg 2+ , Cl - , SO 4 2- , NO 3 - have different degrees of accumulation. Studies have shown that the cation composition in this type of soil,...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N1/21C12N15/70C12N9/06C12R1/19C12R1/465
CPCY02A40/10
Inventor周培冯海玮孙玉静支月娥唐冬卫星罗艳青毛亮
OwnerSHANGHAI JIAO TONG UNIV