A kind of Aspergillus niger strain with high fructose transferase and its application
A fructose transferase, Aspergillus niger technology, applied in the directions of transferase, enzyme, fungi, etc., can solve the problems of high production cost, high price, low yield, etc., achieve small colony, reduce production cost, mycelium The effect of many branches
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] Cloning of embodiment 1 fructose transferase gene
[0016] According to the amino acid and DNA sequence of Aspergillus niger fructosyltransferase published by NCBI, primers were designed:
[0017] Upstream primer: CCTTAATTAAATGAAGCTTCAAACGGCTTCCGTAC;
[0018] Downstream primer: TGCTCTAGATTAAGACTGACGATCCGGCCAAGCA;
[0019] Aspergillus niger ( Aspergillus niger ) G1 genome as a template, using the above primers for PCR amplification, PCR conditions: 98°C 30s; 98°C 10s, 72°C 60s, 30 cycles; 72°C 10min; 4°C hold. Gel recovery of PCR products. After sequencing analysis, the nucleotide sequence of the PCR product is SEQ ID NO: 2, and the encoded amino acid sequence is SEQ ID NO: 1, which is a new fructose transferase.
Embodiment 2
[0020] Embodiment 2, the construction of fructose transferase gene recombination vector
[0021] The above PCR product was double-digested with PacI and XbaI, subjected to agarose gel electrophoresis, and the fragment of the digested product was recovered by cutting the gel, ligated with the plasmid pGm that was also double-digested with PacI and XbaI and recovered by cutting the gel, and transformed into competent Escherichia coli ( E. coli ) after DH5α, selection was performed with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen), and the recombinant plasmid was named pGm-ftl.
[0022] Refer to Table 1 for enzyme digestion and ligation reactions.
[0023]
Embodiment 3
[0024] Example 3 Transformation of host bacteria Aspergillus niger and screening and identification of recombinants
[0025] (1) Inoculate fresh spores of Aspergillus niger G1 strain in a shake flask containing 100ml of CMA medium, and incubate at 30°C and 200rpm for 12 hours;
[0026] (2) Filter the bacteria obtained in (1) with 4 layers of sterile gauze, rinse with sterile water for 3 times, and then rinse with solution A for 3 times;
[0027] (3) Under sterile conditions, transfer the washed mycelia to the protoplast solution, incubate at 30°C and 200rpm for 2 hours, and monitor the progress of protoplastization by microscope observation;
[0028] (4) Use sterile Micra-Cloth to filter the protoplastization reaction into two 50ml sterile disposable centrifuge tubes, and dilute the volume of each tube to 45ml with solution B, and centrifuge at 4000 rpm for 10 min. Discard the supernatant; add 20 ml solution B to the tube, mix well, centrifuge at 4000 rpm for 5 min, discard t...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap