A kind of Aspergillus niger strain with high fructose transferase and its application

A fructose transferase, Aspergillus niger technology, applied in the directions of transferase, enzyme, fungi, etc., can solve the problems of high production cost, high price, low yield, etc., achieve small colony, reduce production cost, mycelium The effect of many branches

Active Publication Date: 2020-05-05
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF11 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] At present, the main bottleneck in the production of fructooligosaccharides is the low yield (40% to 60%), which leads to high production costs and high prices

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of Aspergillus niger strain with high fructose transferase and its application
  • A kind of Aspergillus niger strain with high fructose transferase and its application
  • A kind of Aspergillus niger strain with high fructose transferase and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Cloning of embodiment 1 fructose transferase gene

[0016] According to the amino acid and DNA sequence of Aspergillus niger fructosyltransferase published by NCBI, primers were designed:

[0017] Upstream primer: CCTTAATTAAATGAAGCTTCAAACGGCTTCCGTAC;

[0018] Downstream primer: TGCTCTAGATTAAGACTGACGATCCGGCCAAGCA;

[0019] Aspergillus niger ( Aspergillus niger ) G1 genome as a template, using the above primers for PCR amplification, PCR conditions: 98°C 30s; 98°C 10s, 72°C 60s, 30 cycles; 72°C 10min; 4°C hold. Gel recovery of PCR products. After sequencing analysis, the nucleotide sequence of the PCR product is SEQ ID NO: 2, and the encoded amino acid sequence is SEQ ID NO: 1, which is a new fructose transferase.

Embodiment 2

[0020] Embodiment 2, the construction of fructose transferase gene recombination vector

[0021] The above PCR product was double-digested with PacI and XbaI, subjected to agarose gel electrophoresis, and the fragment of the digested product was recovered by cutting the gel, ligated with the plasmid pGm that was also double-digested with PacI and XbaI and recovered by cutting the gel, and transformed into competent Escherichia coli ( E. coli ) after DH5α, selection was performed with ampicillin. To ensure accuracy, several clones were sequenced (Invitrogen), and the recombinant plasmid was named pGm-ftl.

[0022] Refer to Table 1 for enzyme digestion and ligation reactions.

[0023]

Embodiment 3

[0024] Example 3 Transformation of host bacteria Aspergillus niger and screening and identification of recombinants

[0025] (1) Inoculate fresh spores of Aspergillus niger G1 strain in a shake flask containing 100ml of CMA medium, and incubate at 30°C and 200rpm for 12 hours;

[0026] (2) Filter the bacteria obtained in (1) with 4 layers of sterile gauze, rinse with sterile water for 3 times, and then rinse with solution A for 3 times;

[0027] (3) Under sterile conditions, transfer the washed mycelia to the protoplast solution, incubate at 30°C and 200rpm for 2 hours, and monitor the progress of protoplastization by microscope observation;

[0028] (4) Use sterile Micra-Cloth to filter the protoplastization reaction into two 50ml sterile disposable centrifuge tubes, and dilute the volume of each tube to 45ml with solution B, and centrifuge at 4000 rpm for 10 min. Discard the supernatant; add 20 ml solution B to the tube, mix well, centrifuge at 4000 rpm for 5 min, discard t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention provides an Aspergillus niger mutant strain with an accession number of CCTCC No. M2015485. The Aspergillus niger mutant strain FTLM obtained through an ultraviolet mutagenesis method can efficiently express fructose transferase from Aspergillus niger and has high fermentation enzyme activity of 455 U / mL, increased by 25% compared with an original strain. Compared with the original strain, the mutant strain has the advantages of a small and dense bacterial colony, a great amount of produced spores, considerable short mycelium branches and denser mycelium growth, is more suitable for high-density fermentation and can reduce production cost for fructose transferase.

Description

technical field [0001] The invention belongs to the technical fields of enzyme gene engineering technology and microorganism mutagenesis screening, and specifically relates to a high-yield fructose transferase Aspergillus niger strain and application thereof. Background technique [0002] Fructose-oligosaccharides (oligofructose or saccharose triose oligosaccharides) are a series of fructo-oligomers formed by linking 1 to 3 fructosyls on the fructosyls of sucrose through β-1,2 glycosidic bonds. FOS is difficult to be hydrolyzed by human digestive tract salivary enzymes and small intestinal digestive enzymes, it is a low-calorie sugar; it can prevent dental caries; FOS can be selectively utilized by bifidobacteria to promote their growth and increase the growth of beneficial bacteria in the intestine , effectively inhibit the reproduction of harmful bacteria, improve immunity, and delay aging; fructooligosaccharides can also improve lipid metabolism, lower blood lipids and ch...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N1/15C12N13/00C12N9/10C12R1/685
Inventor 王华明林艳梅
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap