A colorimetric sensor based on cadmium-based functional nucleic acid and its application
A technology of colorimetric sensors and functional nucleic acids, applied in the field of colorimetric sensors for functional nucleic acids, can solve problems such as low sensitivity, poor repeatability, and limitations, and achieve high specificity and sensitivity, resistance to high salt costs, and high specificity Effect
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0054] Embodiment 1: Construction method of the colorimetric sensor based on functional nucleic acid
[0055] 1. Experimental materials
[0056] Potassium Chloride, Sodium Chloride, Magnesium Chloride, Potassium Hydrogen Phosphate, Disodium EDTA, Thioflavin, Tris, Cadmium Chloride, Urea, Nt.BstNBI Notch Endonuclease, Bst DNA polymerase, 4-hydroxyethylpiperazineethanesulfonic acid (HEPES), sodium hydroxide, disodium hydrogen phosphate.
[0057] 2. Sequence design
[0058] Design and synthesize DNAzyme substrate strands, DNAzyme enzyme strands and amplification templates. In the amplification template, GACTC is the Nt.BstNBI nicking endonuclease recognition sequence, and the first four base pairs of the sequence (between C and A) are the synthetic strand cleavage sites; the CGGCCGGG sequence at the end of the deoxyribozyme substrate chain is In order to increase the binding Tm value with the amplified template; the cadmium ion cutting site is after the rA of the deoxyribozyme...
Embodiment 2
[0081] Embodiment 2: the detection of cadmium ion
[0082] The detection of cadmium ion concentration, the specific steps are as follows:
[0083] (1) Prepare a standard curve of fluorescence intensity as a function of cadmium ion concentration
[0084] Adopt the construction method of 3 in the embodiment 1, the cadmium ion solution to be measured is a cadmium chloride standard solution (1M NaCl is a dissolution environment), and the cadmium chloride concentration is 30pM, 4560pM, 75pM, 90pM and 115pM, and the excitation wavelength is set at 425nm. Prepare the standard curve ( image 3 ), the standard curve is y=108.10-773.10, R 2 = 0.9998.
[0085] (2) In the present embodiment, the cadmium ion solution to be measured is a different concentration of cadmium chloride solution (NaCl is the dissolution environment)
[0086] Using the construction method in 3 in Example 1, measure the fluorescence intensity of the cadmium ion solution to be tested, and substitute it into the ...
Embodiment 3
[0089] Embodiment 3: A kind of kit that detects cadmium ion
[0090] A kit for detecting cadmium ions, comprising a cadmium ion deoxyribozyme system, an isothermal amplification system and a color development system;
[0091] Cadmium ion deoxyribozyme system includes substrate chain, enzyme chain, buffer, cadmium ion standard solution and stop solution;
[0092] The isothermal amplification system includes amplification template, dNTPs, ultrapure water, Bst DNA polymerase, polymerase reaction buffer solution, Nt.BstNBI nicking endonuclease and Nt.BstNBI nicking endonuclease reaction buffer solution;
[0093] The chromogenic system includes: thioylavin stock solution and chromogenic buffer.
[0094] The sequence (5'-3') of the DNAzyme substrate chain is: CTCACTATArAGGAAGAGATGCGGCCGGG;
[0095] The sequence (5'-3') of the deoxyribozyme enzyme chain is: CATCTCATCTAACAGCGTTCCGAAATAGC;
[0096] The sequence (5'-3') of the amplification template is: CCCAACCCGCCCTACCCCCCAACCCGCCCT...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


