Unlock instant, AI-driven research and patent intelligence for your innovation.

A colorimetric sensor based on cadmium-based functional nucleic acid and its application

A technology of colorimetric sensors and functional nucleic acids, applied in the field of colorimetric sensors for functional nucleic acids, can solve problems such as low sensitivity, poor repeatability, and limitations, and achieve high specificity and sensitivity, resistance to high salt costs, and high specificity Effect

Active Publication Date: 2020-10-02
CHINA AGRI UNIV
View PDF5 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods rely on large-scale instruments and special personnel to operate, and are limited in field and field detection
Chemical sensing methods represented by small organic molecules such as ethers, polyamines, and aromatic hydrocarbons have also been developed to a certain extent, but at present there are shortcomings such as low sensitivity, poor repeatability, and the detection needs to be carried out in organic solvents. Reliability and usability are not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A colorimetric sensor based on cadmium-based functional nucleic acid and its application
  • A colorimetric sensor based on cadmium-based functional nucleic acid and its application
  • A colorimetric sensor based on cadmium-based functional nucleic acid and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0054] Embodiment 1: Construction method of the colorimetric sensor based on functional nucleic acid

[0055] 1. Experimental materials

[0056] Potassium Chloride, Sodium Chloride, Magnesium Chloride, Potassium Hydrogen Phosphate, Disodium EDTA, Thioflavin, Tris, Cadmium Chloride, Urea, Nt.BstNBI Notch Endonuclease, Bst DNA polymerase, 4-hydroxyethylpiperazineethanesulfonic acid (HEPES), sodium hydroxide, disodium hydrogen phosphate.

[0057] 2. Sequence design

[0058] Design and synthesize DNAzyme substrate strands, DNAzyme enzyme strands and amplification templates. In the amplification template, GACTC is the Nt.BstNBI nicking endonuclease recognition sequence, and the first four base pairs of the sequence (between C and A) are the synthetic strand cleavage sites; the CGGCCGGG sequence at the end of the deoxyribozyme substrate chain is In order to increase the binding Tm value with the amplified template; the cadmium ion cutting site is after the rA of the deoxyribozyme...

Embodiment 2

[0081] Embodiment 2: the detection of cadmium ion

[0082] The detection of cadmium ion concentration, the specific steps are as follows:

[0083] (1) Prepare a standard curve of fluorescence intensity as a function of cadmium ion concentration

[0084] Adopt the construction method of 3 in the embodiment 1, the cadmium ion solution to be measured is a cadmium chloride standard solution (1M NaCl is a dissolution environment), and the cadmium chloride concentration is 30pM, 4560pM, 75pM, 90pM and 115pM, and the excitation wavelength is set at 425nm. Prepare the standard curve ( image 3 ), the standard curve is y=108.10-773.10, R 2 = 0.9998.

[0085] (2) In the present embodiment, the cadmium ion solution to be measured is a different concentration of cadmium chloride solution (NaCl is the dissolution environment)

[0086] Using the construction method in 3 in Example 1, measure the fluorescence intensity of the cadmium ion solution to be tested, and substitute it into the ...

Embodiment 3

[0089] Embodiment 3: A kind of kit that detects cadmium ion

[0090] A kit for detecting cadmium ions, comprising a cadmium ion deoxyribozyme system, an isothermal amplification system and a color development system;

[0091] Cadmium ion deoxyribozyme system includes substrate chain, enzyme chain, buffer, cadmium ion standard solution and stop solution;

[0092] The isothermal amplification system includes amplification template, dNTPs, ultrapure water, Bst DNA polymerase, polymerase reaction buffer solution, Nt.BstNBI nicking endonuclease and Nt.BstNBI nicking endonuclease reaction buffer solution;

[0093] The chromogenic system includes: thioylavin stock solution and chromogenic buffer.

[0094] The sequence (5'-3') of the DNAzyme substrate chain is: CTCACTATArAGGAAGAGATGCGGCCGGG;

[0095] The sequence (5'-3') of the deoxyribozyme enzyme chain is: CATCTCATCTAACAGCGTTCCGAAATAGC;

[0096] The sequence (5'-3') of the amplification template is: CCCAACCCGCCCTACCCCCCAACCCGCCCT...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a colorimetric sensor for cadmium-based functional nucleic acid and application of the colorimetric sensor in the technical field of metal ion detection. The colorimetric sensor comprises a molecular recognition element, a signal amplification element and a signal conversion element, wherein the molecular recognition element comprises a cadmium ion deoxyribozyme, and the cadmium ion deoxyribozyme comprises a substrate chain and an enzyme chain; the signal amplification element comprises an isothermal amplification system, and the isothermal amplification system comprises an amplification template; the signal conversion element comprises a thioflavin. The colorimetric sensor is based on the cadmium ion deoxyribozyme, equivalent temperature index amplification reaction and the G-quadruplex liquid phase sensing technology, the molecular recognition element recognizes cadmium ions and generates amplification products, and a G-quadruplex structure is formed by the amplification products under the action of thioflavin. The concentration of the cadmium ions is calculated by detecting the fluorescence intensity, and the colorimetric sensor has the advantages of being simple, quick, high in sensitivity, high in specificity, high in salt resistance, low in cost and the like and can be used for on-site detection of the cadmium ions in the environment.

Description

technical field [0001] The invention belongs to the technical field of metal ion detection, and in particular relates to a cadmium-based functional nucleic acid colorimetric sensor and an application thereof. Background technique [0002] Cadmium is a blue-white, important, transition-state heavy metal element, which is toxic, but is widely used in industrial production due to its good flexibility and oxidation resistance. In the 1960s, cadmium poisoning was reported for the first time in Japan, which attracted people's attention. Studies have shown that cadmium can enter the organism through the respiratory tract and digestive tract, and the cadmium entering the body can cause damage to a series of important organs such as liver, kidney, bone, brain and lung, and also cause damage to the nervous, reproductive and immune systems. [0003] Liver and kidney are the main target organs of cadmium poisoning, and the toxicity of cadmium to liver and kidney shows obvious time-conc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): G01N21/64
CPCG01N21/6428
Inventor 许文涛罗云波黄昆仑肖冰贺晓云田晶晶翟百强徐瑗聪
Owner CHINA AGRI UNIV