Supercharge Your Innovation With Domain-Expert AI Agents!

A chloroplast positioning gene toxabp1-v and its application

A toxabp1-v, gene technology, applied to the chloroplast localization gene ToxABP1-V and its application fields, can solve the problems of environmental pollution, increase of manpower, material resources and the like

Active Publication Date: 2021-05-11
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Powdery mildew can be controlled by fungicides, but chemical control will inevitably increase manpower and material resources, and will also cause ecological problems such as environmental pollution. Therefore, discovering disease-resistant genes and cultivating disease-resistant varieties are effective measures to prevent and control wheat powdery mildew

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A chloroplast positioning gene toxabp1-v and its application
  • A chloroplast positioning gene toxabp1-v and its application
  • A chloroplast positioning gene toxabp1-v and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0023] Example 1 Screening of CMPG1-V interacting proteins by yeast two-hybrid and cloning of ToxABP1-V gene

[0024] CMPG1-V is a powdery mildew resistance-related gene located on diploid T. villosa 6V cloned by the Institute of Cytogenetics, Nanjing Agricultural University (references: Zhu, Y., Li, Y., Fei, F., Wang , Z., Wang, W., Cao, A., Liu, Y., Han, S., Xing, L., Wang, H., Chen, W., Tang, S., Huang, X., Shen ,Q.,Xie,Q.,and Wang,X..E3ubiquitin ligase geneCMPG1-V from Haynaldia villosa L.contributes topowdery mildew resistance in common wheat(Triticum aestivum L.).The PlantJournal.2015.84,154-168), with CMPG1-V was used as bait, and the yeast two-hybrid cDNA library was screened by polyethylene glycol-lithium acetate transformation method to obtain an interacting gene of CMPG1-V ( figure 1 ). The interaction gene was sequenced, and the sequence encoded a C-terminal 186 amino acids of ToxinA binding protein1, and homologous cloning primers P1 (CAATAGCCTTTCCTCGCACCTG, SEQ...

Embodiment 2

[0025] Example 2 ToxABP1-V gene is induced by powdery mildew expression characteristics

[0026] The powdery mildew-resistant wheat seeds (references: Qi Lili, Chen Peidu, etc., New source of resistance to powdery mildew in wheat—gene Pm21, Acta Crops, 1995, 21(3):257-262) were sown in a petri dish to germinate , transplanted to pots after dew whitening (isolated with cylindrical transparent plastic sheets around, and closed with filter paper at the top to form an environment without powdery mildew). At the three-leaf stage, shake off the fresh spores of Nanjing local mixed powdery mildew cultured on the susceptible variety Sumai No. 3 on the seedlings of A. After being inoculated with powdery mildew, the wheat tufting continued to be cultured at 16°C. Samples were taken at 0h, 0.5h, 1h, 2h, 4h, 6h, 8h, 10h, 12h, 24h, 48h, and 72h after inoculation, and stored in a -70°C refrigerator for later use. TRIZOL (Invitrogen) was used to extract RNA from the leaves of A. villosa induc...

Embodiment 3

[0030] Example 3 Using single cell silencing method to transfer ToxABP1-V gene RNAi vector into wheat leaves

[0031] The single-cell transient silencing method is a reliable and rapid method for identifying gene functions (reference: Schweizer, Pokorny et al. A Transient Assay System for the Functional Assessment of Defense-Related Genes in Wheat Molecular Plant-MicrobeInteractions.1999,12:647 -654). In this study, the single-cell instantaneous silencing method was used to wrap the plasmid DNA on the outer layer of metal particles, and the metal particles were bombarded to the epidermal cells of wheat leaves with the help of a gene gun. It has powdery mildew resistance function.

[0032] The procedure for encapsulating carrier DNA and metal particles is as follows:

[0033] Preparation of tungsten powder: Weigh 30mg of tungsten powder into a 1.5ml eppendorf tube, add 1ml of 70% alcohol, vortex for 3-5min and then let stand for 15min to completely precipitate the gold powder...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a chloroplast positioning gene ToxABP1‑V and its application. The cDNA sequence of ToxABP1‑V is SEQ ID NO.1 and the encoded amino acid sequence is SEQ ID NO.3. The gene comes from diploid Trichopyrhiza, can interact with powdery mildew resistance-related gene CMPG1‑V, and its expression is down-regulated by powdery mildew-resistant diploid Trichopyrhiza. The gene RNAi silencing vector pWMB006‑ToxABP1 was transformed into the susceptible wheat variety Yangmai 158 by single-cell transient silencing technology, and the results showed that transient silencing of ToxABP1 could reduce the haustoria index of Yangmai 158. Three positive RNAi transgenic plants were obtained by transgenic technology, which showed medium to high resistance to wheat powdery mildew. Therefore, ToxABP1‑V is expected to be used in genetic engineering breeding.

Description

technical field [0001] The invention belongs to the field of genetic engineering and discloses a chloroplast positioning gene ToxABP1-V and its application. Background technique [0002] Wheat powdery mildew, caused by the obligate parasitic fungus Blumeria graminis DC f.sp.tritici, is one of the most serious leaf diseases of wheat (Triticum aestivum L., 2n=6x=42, genome AABBDD). Occurs widely in China and many other countries. The disease can occur throughout the growth period of wheat, and can infect all parts of aboveground wheat plants, mainly leaves and leaf sheaths. [0003] With the influence of cultivars, cultivation conditions and climatic conditions, the harm of wheat powdery mildew in my country is increasing. Powdery mildew can be controlled with fungicides, but chemical control will inevitably increase the input of manpower and material resources, and will also cause ecological problems such as environmental pollution. Therefore, discovering disease-resistant ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/29C07K14/415C12N15/82A01H5/00A01H6/46
CPCC07K14/415C12N15/8218C12N15/8282
Inventor 王秀娥王宗宽李颖波樊安琪张恒赵佳王海燕肖进曹爱忠邢莉萍
Owner NANJING AGRICULTURAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More