A kind of nitroreductase gene cnrb and its coded protein and application
A technology of reductase and nitro, applied in the direction of oxidoreductase, application, genetic engineering, etc., can solve problems such as blood red blood cell reduction, body disease, digestive system toxicity damage, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0042] The cultivation of embodiment 1 bacterial strain LMS-CY and the cloning of chloramphenicol nitroreductase gene cnrB
[0043] The strain LMS-CY, identified as Nocardioides sp., has been preserved in the China Center for Type Culture Collection (CCTCC for short), the preservation time is October 24, 2016, and the preservation number is CCTCC NO: M2016591, the strain has been preserved in the patent (CN106754578A).
[0044] 1. Extraction of bacterial genome total DNA
[0045] LB medium formula (1L) is: NaCl 10g, peptone 10g, yeast extract 5g, pH7.2-7.5.
[0046] After the strain LMS-CY (CCTCC NO:M 2016591) was mass-cultured in LB medium, the total genomic DNA of LMS-CY with high purity and large fragments was extracted by CTAB method, and dissolved in TE buffer (pH8.0) , and stored at -20°C. For specific methods, refer to the "Refined Molecular Biology Experiment Guide" edited by F. Osper et al.
[0047] 2. Draft genome sequencing and result analysis
[0048]Bacterial ...
Embodiment 2
[0052] Example 2 Gene cnrB sequence verification
[0053] The obtained chloramphenicol nitroreductase gene cnrB was directionally cloned into the broad host vector Rosetta (pET-28a(+)), and chloramphenicol was used as a substrate to verify whether the sequence was functional.
[0054] 1. PCR amplification of sequence
[0055] Design primers to amplify the target gene:
[0056] Forward primer SEQ3: catgccatggggatctcctacgacatcacg;
[0057] Reverse primer SEQ4: ccgctcgaggtcgtcgtcgtcccataaga.
[0058] A chloramphenicol nitroreductase gene fragment was amplified from the total DNA genome of strain LMS-CY.
[0059] PCR amplification system (50μL):
[0060]
[0061] Add sterilized ddH 2 0 to 50 μL
[0062] PCR amplification program:
[0063] Denaturation at 98°C for 3min; denaturation at 98°C for 10s; annealing at 58°C for 10s; extension at 72°C for 15s; further extension for 10min, and cooling to room temperature.
[0064] The agarose gel electrophoresis figure of the PCR...
Embodiment 3
[0080] Example 3 High expression of chloramphenicol nitroreductase gene cnrB in Rosetta (DE3) (pET-28a (+))
[0081] Pick the plasmid extracted from the positive clone in Example 2 and transform it into the expression host bacterium Rosetta (DE3) (refer to Example 2 for the transformation method), and introduce the recombinant vector pET28a-cnrB into Escherichia coli Rosetta (DE3) to obtain the recombinant gene Engineering strains, spread on a plate containing 50mg / L kanamycin, in a 37°C incubator, culture upside down overnight, pick a positive transformant (that is, a single colony Rosetta(DE3) / pET28a-cnrB cultured overnight), nitrify The expression process of base reductase gene cnrB in Rosetta(DE3) is as follows: image 3 shown.
[0082] Pick positive transformants and inoculate them into fresh LB liquid medium (containing 50mg / L kanamycin) and culture at 37°C for about 4 hours, OD 600 0.6, add IPTG with a final concentration of 0.6mM, collect the bacteria after induction...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More