2-methyl citric acid high-yield genetic engineering bacterium and construction method thereof

A technology of methyl citric acid and genetically engineered bacteria, applied in the field of genetic engineering, can solve the problems of difficult purification, high price, and poor selectivity of chemical synthesis methods, and achieve the effects of reducing production costs and increasing yields

Active Publication Date: 2019-01-04
HUBEI ENG UNIV
View PDF4 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the chemical synthesis method is often poor in selectivity, resulting in the synthesis of 2-methylcitric acid as a mixture of four enantiomers.
At the same time, the chemical synthesis process is complicated and the subsequent purification is extremely difficult, which directly leads to the price of 2-methylcitric acid being higher than gold (only 10mg costs about 1,500 yuan)

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 2-methyl citric acid high-yield genetic engineering bacterium and construction method thereof
  • 2-methyl citric acid high-yield genetic engineering bacterium and construction method thereof
  • 2-methyl citric acid high-yield genetic engineering bacterium and construction method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] The construction of engineering bacteria of high yield 2-methylcitric acid of embodiment 1

[0034] 1. Construction of knockout vector pRP1028-prpD-U-D

[0035] Using Bacillus thuringiensis BMB171 as the starting strain, according to the gene sequence of prpD and its upstream and downstream DNA sequences, primers for upstream and downstream homologous fragments were designed respectively, wherein the nucleic acid sequence of prpD is shown in SEQ ID NO:1,

[0036]ATGATTAAAACAAATGAAATTAAGCAAAAAGATGCATTATTAGAAGAGATTACCGATTATGTATTAAATAAAGAGGTTACTAGTGCAGAAGCATTCAGTACAGCTCGTTACGTATTACTTGATACACTTGGATGTGGAATTTTAGCACTGCAATATCCAGAATGTACGAAATTACTAGGACCAGTTGTGCCAGGAACAATCGTGCCAAATGGTACACGTGTACCAGGTACGTCTTATGTACTAGATCCAGTAAAAGGTGCATTTAATATCGGATGTATGATCCGTTGGTTAGACTATAACGATACTTGGCTTGCAGCAGAGTGGGGACATCCATCTGATAACCTAGGCGGAATTTTAGCAGTTGCAGATTATATTAGCCGTGTTCGTATTTCAGAAGGAAAAGAAGCTTTAAAAGTACGTGAAGTATTAGAAATGATGATTAAAGCACATGAAATTCAAGGCGTGCTTGCTTTAGAAAACAGCTTAAACAGAGTTGGTCTTGACCATGTATTATATGT...

Embodiment 2

[0056] Determination of 2-methylcitric acid synthesis time point in embodiment 2 Bacillus thuringiensis

[0057] 1. Transcription fusion vector pHT1K-P prpC -Construction and extraction of lacZ

[0058] The plasmid pHT1K containing lacZ was selected as the transcriptional fusion vector from the plasmid preserved in our laboratory. The plasmid pHT1K-lacZ contains ampicillin (Amp) resistance and erythromycin (Ery) resistance, and its nucleotide sequence is as SEQ ID NO: 11.

[0059] The total DNA of BMB171 was used as the template of the PCR amplification reaction, and the primer P prpC -lacZ-F and primer P prpC -lacZ-R amplified to obtain the prpC promoter fragment. where primer P prpC -lacZ-F and primer P prpC The sequences of -lacZ-R are respectively shown in SEQ ID NO: 8 and SEQ ID NO: 9:

[0060] CCCCCATGGTAACTTTATTAAAAAATGA (SEQ ID NO: 8)

[0061] GGATCCTATTTCCTCCAATCCTAATAG (SEQ ID NO:9)

[0062] The PCR configuration system is: DNA template 1 μL, primer P prpC ...

Embodiment 3

[0072] Example 3 Extraction and content determination of intracellular 2-methylcitric acid in Bacillus thuringiensis

[0073] 1. Extraction method

[0074]The crude product of 2-methylcitric acid was obtained by ultrasonic crushing combined with pre-treatment of organic solvent for impurity removal. The specific steps are: culture BMB171 or ΔprpD strain in GYS medium for 6h or 12h, collect 35mL bacterial liquid, centrifuge at 12,000r / min for 2min, discard supernatant, add 10mL ddH2O to suspend bacterial cells; place in ice bath water, use Ultrasonic cell disruptor (Ningbo Xinzhi Biotechnology Co., Ltd.) was crushed for 30 minutes (ultrasonic power: 250W, ultrasonic work 1.0s, ultrasonic stop 1.5s, so repeated, a total of 30min); then, centrifuge at 12,000rpm for 5min, and collect the supernatant ;Take 3.5mL supernatant, add 31.5mL acetone, shake vigorously on the shaker for 1min, centrifuge at 12,000rpm for 5min, discard the supernatant; put the centrifuge tube with brownish-...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of genetic engineering and relates to a 2-methyl citric acid high-yield genetic engineering bacterium and a construction method thereof. The 2-methyl citric acid high-yield genetic engineering bacterium is obtained by knocking out a 2-methyl citric acid dehydrase gene prpD in a bacillus thuringiensis BMB171 genome. According to the construction method of the 2-methyl citric acid high-yield genetic engineering bacterium, bacillus thuringiensis BMB171 is adopted as an original strain to successfully obtain a 2-methyl citric acid dehydrase gene prpD traceless deletion mutant strain delta prpD by the aid of a homing endonuclease I-SceI induced chromosome homologous recombination mechanism based gene knockout system. According to liquid chromatography and mass spectrometry detection, the intracellular 2-methyl citric acid concentration of delta prpD strain is increased by 217 times as compared with that of the original strain BMB171, and the 2-methyl citric acid prepared according to the method is specific in steric configuration as compared with 2-methyl citric acid synthesized according to a chemical method.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a 2-methylcitric acid high-yielding genetically engineered bacterium and a construction method thereof. Background technique [0002] Bacillus thuringiensis (Bt) is a rod-shaped, spore-forming, Gram-positive bacterium that is widely distributed in soil, plant leaf surfaces, and plant rhizosphere, and is also an important insect pathogen. The most notable feature of Bt is that it produces parasporal crystals composed of insecticidal crystal proteins during the formation of spores, so it is widely used as a microbial insecticide with high insecticidal activity, wide insecticidal spectrum, and is safe for humans and animals. Environmentally friendly and other advantages. At the same time, Bt is an ideal host for constructing various engineering strains because of its short culture period and strong central metabolism. The Bacillus thuringiensis amorphous mutant strain ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12N15/63C12N15/90C12N15/65C12P7/48C12R1/07
CPCC12N9/88C12N15/63C12N15/65C12N15/902C12P7/48C12Y402/01079
Inventor都萃颖郑操张中强李国元戴余军
OwnerHUBEI ENG UNIV