Application of D-34 protein and heat protection agent with D-34 protein
A technology of D-34 and heat protectant, which is applied in the field of protein stabilizers, can solve the problems of protein, enzyme, antibody products and limited cell protection, and achieve the effect of improving cell heat resistance and avoiding biological activity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0039] Construction and expression of D-34 protein:
[0040] Primers F:5'GGATCCATGAGCCAGGAACAGCTCAAGA 3'(SEQ ID NO:2) and R:5'AAGCTTTCACGCATCAGTCACTTGTC3'(SEQ ID NO:3) were designed according to the D-34 gene sequence shown in SEQ ID NO:1. Use soybean cDNA as a template for PCR amplification, carry out BamH I and HindIII double digestion of the amplified PCR fragment, and connect it to the pET28a vector that has been cut by the same double digestion, transform Top10 through ligation, and screen on the LB plate containing Kana Positive clones were identified by plasmid PCR and sequenced after being correct. The recombinant expression plasmid was extracted and transformed into Escherichia coli BL21Star for protein expression, and the protein was purified by affinity chromatography.
[0041] The parameters of the chromatography column used are as follows: column length: 20cm; diameter: 16mm, filler: Chelating Sepharose FastFlow 4BTM, filler volume: 10mL; manufacturer: Amersham B...
Embodiment 2
[0043] Effect of D-34, D-34+trehalose on CS thermal aggregation experiment:
[0044] In order to detect the inhibitory effect of D-34 protein on the thermal aggregation of CS (Citroyl Synthetase, sigma), CS (0.08mg / ml) was figure 2 After mixing the ratio of D-34 protein with different concentrations, BSA (bovine serum albumin, Sanko) and trehalose, keep the temperature at 45°C for 1h, and measure A on a UV spectrophotometer. 400 . Absorbance at 400 nm will increase as protein aggregation occurs. Taking the aggregation degree of CS treated with no protein as 100%, the thermal aggregation degree of CS in each group is as follows: figure 2 shown. Depend on figure 2 It is known that the protein BSA in the control group has no obvious inhibitory effect on the thermal aggregation of CS; while the D-34 protein group has a significant inhibitory effect on the thermal aggregation of CS, and the inhibitory effect is more obvious with the increase of the concentration. In the gro...
Embodiment 3
[0046] D-34, D-34+trehalose thermal protection experiments on ADH enzyme activity:
[0047] In order to detect the protective effect of D-34 protein on ADH (alcohol dehydrogenase, 10mm Tris-HCI ph=7.5, sigma) enzymatic activity, ADH (0.2mg / ml) according to image 3 The proportion in the mixture was mixed with D-34 protein, BSA (bovine serum albumin, Sanko) or trehalose and treated at 55°C for 1.5h to measure the enzyme activity. 0.1 mL of the above liquid was added to a system consisting of 1.4 mL of buffer solution (50 mm Tris-HCl pH=8.8), 0.1 mL of absolute ethanol and 1.4 mL of 0.025M NAD. Constant temperature at 25°C, continuous determination of A 340 , measured once every 10s, measured for 2 minutes in total, processed the data, and calculated the residual enzyme activity of ADH in each group, the results were as follows image 3 shown. Depend on image 3 It is known that both the D-34 protein group and the control protein BSA group have obvious protective effects on ...
PUM
| Property | Measurement | Unit |
|---|---|---|
| diameter | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com



