Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Application of D-34 protein and heat protection agent with D-34 protein

A technology of D-34 and heat protectant, which is applied in the field of protein stabilizers, can solve the problems of protein, enzyme, antibody products and limited cell protection, and achieve the effect of improving cell heat resistance and avoiding biological activity

Inactive Publication Date: 2019-05-10
SHENZHEN UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] The purpose of the present invention is to overcome the above-mentioned deficiencies of the prior art, provide a kind of application of D-34 protein and protein thermoprotectant, to solve the limited effect of existing protein stabilizer on protein, enzyme, antibody preparation and cell protection at high temperature technical issues

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Application of D-34 protein and heat protection agent with D-34 protein
  • Application of D-34 protein and heat protection agent with D-34 protein
  • Application of D-34 protein and heat protection agent with D-34 protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] Construction and expression of D-34 protein:

[0040] Primers F:5'GGATCCATGAGCCAGGAACAGCTCAAGA 3'(SEQ ID NO:2) and R:5'AAGCTTTCACGCATCAGTCACTTGTC3'(SEQ ID NO:3) were designed according to the D-34 gene sequence shown in SEQ ID NO:1. Use soybean cDNA as a template for PCR amplification, carry out BamH I and HindIII double digestion of the amplified PCR fragment, and connect it to the pET28a vector that has been cut by the same double digestion, transform Top10 through ligation, and screen on the LB plate containing Kana Positive clones were identified by plasmid PCR and sequenced after being correct. The recombinant expression plasmid was extracted and transformed into Escherichia coli BL21Star for protein expression, and the protein was purified by affinity chromatography.

[0041] The parameters of the chromatography column used are as follows: column length: 20cm; diameter: 16mm, filler: Chelating Sepharose FastFlow 4BTM, filler volume: 10mL; manufacturer: Amersham B...

Embodiment 2

[0043] Effect of D-34, D-34+trehalose on CS thermal aggregation experiment:

[0044] In order to detect the inhibitory effect of D-34 protein on the thermal aggregation of CS (Citroyl Synthetase, sigma), CS (0.08mg / ml) was figure 2 After mixing the ratio of D-34 protein with different concentrations, BSA (bovine serum albumin, Sanko) and trehalose, keep the temperature at 45°C for 1h, and measure A on a UV spectrophotometer. 400 . Absorbance at 400 nm will increase as protein aggregation occurs. Taking the aggregation degree of CS treated with no protein as 100%, the thermal aggregation degree of CS in each group is as follows: figure 2 shown. Depend on figure 2 It is known that the protein BSA in the control group has no obvious inhibitory effect on the thermal aggregation of CS; while the D-34 protein group has a significant inhibitory effect on the thermal aggregation of CS, and the inhibitory effect is more obvious with the increase of the concentration. In the gro...

Embodiment 3

[0046] D-34, D-34+trehalose thermal protection experiments on ADH enzyme activity:

[0047] In order to detect the protective effect of D-34 protein on ADH (alcohol dehydrogenase, 10mm Tris-HCI ph=7.5, sigma) enzymatic activity, ADH (0.2mg / ml) according to image 3 The proportion in the mixture was mixed with D-34 protein, BSA (bovine serum albumin, Sanko) or trehalose and treated at 55°C for 1.5h to measure the enzyme activity. 0.1 mL of the above liquid was added to a system consisting of 1.4 mL of buffer solution (50 mm Tris-HCl pH=8.8), 0.1 mL of absolute ethanol and 1.4 mL of 0.025M NAD. Constant temperature at 25°C, continuous determination of A 340 , measured once every 10s, measured for 2 minutes in total, processed the data, and calculated the residual enzyme activity of ADH in each group, the results were as follows image 3 shown. Depend on image 3 It is known that both the D-34 protein group and the control protein BSA group have obvious protective effects on ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention discloses application of a D-34 protein and a heat protection agent with the D-34 protein. The D-34 protein is used as a heat stabilizer for one or more of proteins, enzymes, antibodiesand cells. The heat protection agent is used for conducting heat protection on one or more of the proteins, enzymes, antibodies and cells, and contains the D-34 protein. The D-34 protein and the heatprotection agent can effectively protect the heat stability of the target proteins, enzymes, antibodies and cells, accordingly, the biological activity of the target proteins, enzymes and antibodies is effectively guaranteed, gathering of the target proteins, enzymes and antibodies is avoided, and the effect of protecting the multiple kinds of proteins, enzymes and antibodies is realized. In thisway, the D-34 protein and the heat protection agent can improve the heat resistance of the cells, and guarantee the activity of the cells in a relatively high temperature environment.

Description

technical field [0001] The invention belongs to the technical field of protein stabilizers, and in particular relates to an application of D-34 protein and a heat protectant containing D-34 protein. Background technique [0002] In the production of modern biomedicine, food production and processing, production and fermentation of microorganisms and cells, many processes require the use of proteins (enzymes) to catalyze reactions. Generally speaking, increasing the temperature will accelerate the enzymatic reaction of protein (enzyme), increase the yield, and shorten the reaction or production cycle; at the same time, increasing the temperature of the reaction will inevitably lead to changes in the protein (enzyme) structure during the reaction and fermentation. Its activity decreased, or even completely inactivated. In addition, during the transportation and storage of proteins and their products (preparations), low-temperature environments or cold chain technology are als...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C07K1/00C07K14/415C12N9/96C12N15/29C12N15/70C12N5/00
Inventor 刘国宝卜友达孙亚军刘昀李承娜郑易之
Owner SHENZHEN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com