Method for quickly detecting specific PCR (polymerase chain reaction) products on basis of analysis on PCR byproduct pyrophosphoric acid and application of method

A detection method and pyrophosphate technology, applied in the biological field, can solve the problems of low copy number of DNA template and cannot be effectively detected, and achieve the effects of accurate qualitative and quantitative analysis, easy implementation and rapid detection

Pending Publication Date: 2019-05-24
SOUTHEAST UNIV
View PDF6 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The detection and analysis method has high sensitivity, fast detection, simple operation process and easy implementation. It can quickly analyze large samples, and at the same time solve the problem that the DNA template copy number is low and cannot be effectively detected. For the detection of low copy number DNA templates, the method of the present invention can reduce or eliminate the background value generated by dATP in blank samples, and can detect low copy number DNA templates quickly and at low cost by directly analyzing pyrophosphate in PCR by-products

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for quickly detecting specific PCR (polymerase chain reaction) products on basis of analysis on PCR byproduct pyrophosphoric acid and application of method
  • Method for quickly detecting specific PCR (polymerase chain reaction) products on basis of analysis on PCR byproduct pyrophosphoric acid and application of method
  • Method for quickly detecting specific PCR (polymerase chain reaction) products on basis of analysis on PCR byproduct pyrophosphoric acid and application of method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035] Detection of Salmonella in Chicken

[0036] 1. Genomic DNA sample preparation: Use PBS (pH=7.2) to wash the bacteria on the surface of the chicken, and then use the bacterial DNA extraction kit (QIAamp fast DNA stool mini kit, Qiagen) to extract the washed bacterial DNA, and store at low temperature spare.

[0037] 2. PCR primer design and PCR reaction

[0038] For the characteristic nucleic acid sequence fragment of Salmonella, the Salmonella invA gene is a gene encoding a secreted virulence protein, which is closely related to the pathogenicity of the bacterium and is unique to the genus Salmonella. The forward primer and reverse primer were designed according to GenBank accession no.M76445.1 :

[0039] SEQ ID NO.1 is forward primer F: 5'-CATCTGTCTCGCCTCCTG-3',

[0040] SEQ ID NO.2 is the reverse primer R: 5'-GGGCCATTTGTCTACTCATA-3';

[0041] (Search the sequence of the amplified gene in the GeneBank database, and submit it to the primer design software Primer5.0 ...

Embodiment 2

[0101] Example 2 adopts the same method as Example 1, except that the pyrophosphate chemiluminescence analysis method uses a pyrophosphate detection kit purchased by SIGMA-ALDRICH Company, and the detection result is similar to that of Example 1.

Embodiment 3

[0103] Detection method of rs11053646 SNP site based on analysis of rolling circle amplification by-product pyrophosphate

[0104] 1. DNA sample extraction and processing: Peripheral blood samples were extracted with traditional protein kinase K and phenol / chloroform extraction methods to extract genomic DNA from peripheral blood. Genomic DNA was digested with restriction enzyme Ase I (New England Biolabs, United States).

[0105] 2. Ring connection reaction:

[0106] (1) Ligation reaction of loop 1: 10 μL reaction volume contains 100 ng of restriction endonuclease Ase I digested genomic DNA, 1 nM of artificially synthesized open loop DNA sequence SEQ ID NO.3: (5'-PO 4 3— AGCCAAGAGAAGTGCGTAACGGTGTGATATGAGCGTGATCGTGCCTTGTCATTCGGGAAACTGGGAAAA G- 3'), 2U Ligase (Epicentre Technologies), 26mmol / L tris-HCl (pH=8.3), 32.5mmol / L KCl, 13mmol / l MgCl 2 , 0.65mmol / L NAD, and 0.013% X-100. Then the reaction was carried out at 95°C for 5 minutes, 40 thermal cycles: denaturation at 9...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for quickly detecting specific PCR (polymerase chain reaction) products on the basis of analysis on a PCR byproduct pyrophosphoric acid and application of the method.The method includes steps of extracting sample genomes for PCR; (2), designing at least one PCR primer and substituting alpha-sulfo-deoxyadenosine triphosphate for deoxyadenosine triphosphate and carrying out PCR amplification; (3), analyzing the pyrophosphoric acid in PCR amplification products; (4), judging whether the PCR is carried out or not according to analysis results and detecting the content of to-be-detected DNA (deoxyribonucleic acid) in samples. The method and the application have the advantages that whether the samples contain sample DNA or not and the content of the sample DNA can be accurately detected by the aid of the method, and the detection limit of the method can reach a plurality of copies; the method for detecting and analyzing the specific PCR products is high in sensitivity, the specific PCR products can be quickly detected by the aid of the method, operation processes are simple and are easy to implement, and large sample specific PCR products can be quicklydetected by the aid of the method; the method can be used for quickly detecting microorganisms in the industry of food, sanitation and the like and also can be used for analyzing other nucleotide sequences with specific PCR.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a rapid detection method for specific PCR products based on the analysis of PCR by-product pyrophosphate and its application, which is suitable for rapid analysis and identification of specific DNA fragments such as food safety, drinking water safety monitoring, and clinical samples . Background technique [0002] PCR technology is a molecular biology technique used to amplify and amplify specific DNA fragments. It can greatly increase a small amount of DNA. Through simple electrophoresis and other rapid methods of analysis, it is possible to clearly judge whether the PCR reaction has occurred through the electrophoresis band. Determine whether a specific DNA fragment is present in a sample. This PCR technology is useful in analysis such as single nucleotide change (SNP, mutation, insertion, seven loss) analysis (such as rolling circle amplification), pathogenic microorganisms (such...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/66C12Q1/6806
Inventor肖鹏峰费中杰
OwnerSOUTHEAST UNIV