A kind of filamentous fungus Aspergillus niger strain for producing biological oil and its application
A technology of Aspergillus niger strain and microbial oil, which is applied in the field of bioengineering, can solve the problems of difficult promotion of biodiesel, high cost of raw materials, aggravated food crisis, etc., and achieves the effects of simple production process control, improved oil production efficiency, and easy acquisition.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0113]Example 1. Isolation and identification of Aspergillus niger E1 strain
[0114]The Aspergillus niger E1 strain of the present invention is isolated from the DY23I voyage overlying water at W154°20'N9°59' in the sea area of the Central Pacific Ocean.
[0115]The genomic DNA of the strain isolated in seawater was extracted, and PCR amplification was performed using fungal universal primers ITS1 and ITS4, and the obtained PCR base sequence (SEQ ID NO.1) was subjected to BLAST comparison analysis in the NCBI database After identification, the strain was found to be a new Aspergillus niger strain, named Aspergillus niger strain E1. Its ITS sequence is shown in SEQ ID NO.1:
[0116]TGGAAGAATGGTTGGAAAACGTCGGCAGGCGCCGGCCAATCCTACAGAGCATGTGACAAAGCCCCATACGCTCGAG GATCGGACGCGGTGCCGCCGCTGCCTTTCGGGCCCGTCCCCCCGGAGAGGGGGACGGCGACCCAACACACAAGCCG GGCTTGAGGGCAGCAATGACGCTCGGACAGGCATGCCCCCCGGAATACCAGGGGGCGCAATGTGCGTTCAAAGACT CGATGATTCACTGAATTCTGCAATTCACATTAGTTATCGCATTTCGCTGCGTTCTTCATCGATGCCGGAACCAAGA GATCC...
Embodiment 2
[0117]Example 2. Cultivation of Aspergillus niger E1 strain and detection of related indexes
[0118]1. Medium preparation
[0119]Preparation of potato dextrose agar medium (PDA): Take 200g potatoes (peeled), cut into small pieces, add about 1L of artificial sea water, boil for 30min, filter with 8 layers of gauze, take the filtrate, add 20g glucose and 15g agar, and dilute the volume with distilled water To 1L, autoclave at 121℃ for 20min.
[0120]The preparation of the seed medium (YEPD): 20g glucose, 10g peptone, 10g yeast powder, prepared with artificial seawater, adjust the pH to 6.0, and dilute to 1L, autoclave at 121°C for 20min.
[0121]Preparation of basic nitrogen-limited lipid-producing medium: 70g glucose, 1.8g peptone, 0.5g yeast powder, KH2PO4 2.0g, MnSO4·H2O 0.005g, CuSO4·5H2O 0.0003g, MgSO4·7H2O 0.8g, prepared with artificial sea water, adjust pH to 6.0, and dilute to 1L, autoclave at 121°C for 20 minutes.
[0122]Preparation of artificial sea water: NaCl 24.477g, Na2SO4 3.9170g, ...
Embodiment 3
[0136]Example 3. Optimization of fermentation conditions and culture medium of Aspergillus niger E1 strain
[0137]1. Optimization of training time
[0138]First, liquid seed culture is performed, and then shake flask fermentation culture is performed. Refer to Example 1 for the specific process. Here, the basic nitrogen-limited lipid-producing medium was used for fermentation culture, and the fermentation culture was continued at 28°C for 9 days and the rotation speed was 160 rpm. Biomass, oil content and oil production were tested for each bacterial liquid of 1, 2, 3, 4, 5, 6, 7, 8, and 9 days of fermentation, and the results are shown infigure 1 in.
[0139]Fromfigure 1 It can be seen that the biomass of the Aspergillus niger E1 strain reached the maximum value of 12.70 g / L when the fermentation and culture reached the 7th day, and the oil content did not reach the maximum value at this time. On the contrary, when the Aspergillus niger E1 strain was fermented to the 5th day, the oil conte...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com