Plant bacterium lacticum LB-1 and application thereof

A technology of Lactobacillus plantarum, CGMCCNO.18215, applied in the direction of bacteria, microorganisms, microorganisms, etc., can solve the problems of mold infection and taste of whole wheat bread, mold contamination of whole wheat bread, poor processing performance of whole wheat dough, etc., and achieve good processing quality, reducing hardness, and improving the effect of flavor components

Active Publication Date: 2019-11-12
NANJING UNIV OF FINANCE & ECONOMICS
View PDF2 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Whole-wheat bread is rich in dietary fiber, minerals, protein, antioxidants and vitamins, but due to its high content of crude fiber and fatty acids, it may lead to poor processing performance of whole-wheat dough, mold contamination of whole-wheat bread and poor taste
At present, the application of lactic acid bacteria in bread fermentation is mostly aimed at refined flour, which has certain limitations in solving the problems of mold infection and poor taste of whole wheat bread

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Plant bacterium lacticum LB-1 and application thereof
  • Plant bacterium lacticum LB-1 and application thereof
  • Plant bacterium lacticum LB-1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0029] The present invention also provides a method for preparing whole wheat bread described in the above scheme, comprising the following steps:

[0030] Mix whole wheat flour, the preparation described in the above scheme, white granulated sugar, active dry yeast, salt and butter to obtain whole wheat dough, and ferment the whole wheat dough at 28-32°C and 80%-90% humidity for 4-6 hours , to obtain fermented dough, the fermented dough is baked to obtain whole wheat bread; the mixing method is preferably stirring and mixing; the rotating speed of the stirring and mixing is preferably 80~120r / min, more preferably 100r / min; the stirring and mixing The time is preferably 5-8min, more preferably 6-7min; the stirring and mixing equipment is preferably a pin-type dough mixer; the size of the fermented dough is preferably 80-120g / piece, more preferably 100g / piece; The fermentation temperature is preferably 30°C; the fermentation humidity is preferably 85%; the fermentation time is ...

Embodiment 1

[0035] The screening of embodiment 1 bacterial strain

[0036] The Lactobacillus plantarum LB-1 of the present invention is isolated and purified from local pickles in Nanjing. In order to select and breed excellent fermentation strains, the present invention adopts the double-layer agar plate method to evaluate its antifungal activity, and concrete operation steps are as follows:

[0037] Pour about 15ml of MRS agar into a culture-based petri dish. After the medium solidifies, drop 5 μL of Lactobacillus plantarum LB-1 bacterial solution in the center of the plate. The concentration of the bacterial solution is 1×10 8 CFU / mL, placed in a sterile fume hood to air dry. Dilute the mold spore suspension to 1 × 10 with PDA agar medium 4 CFU / mL, covered on the MRS agar medium, cultured at 28°C after solidification, observed and measured the size of the inhibition zone.

[0038] As shown in Table 1, when Penicillium, Aspergillus niger, Aspergillus flavus, Aspergillus fumigatus, As...

Embodiment 2

[0041] Embodiment 2: identification of strain

[0042] Bacterial strain of the present invention is carried out 16S rRNA molecular identification, and step is as follows:

[0043] Extract the genome of Lactobacillus plantarum LB-1, through primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3', as shown in SEQ ID NO: 2) and 1492R (5'-GGTTACCTTGTTACGACTT-3', as shown in SEQ ID NO: 3 ) to amplify its 16S rRNA sequence, sequence the amplified product (Nanjing GenScript Biotechnology Co., Ltd.), and compare the sequence in GenBank.

[0044] The results showed that the 16S rRNA sequence comparison showed that the homology between the strain and Lactobacillus plantarum was 100%, so it was determined that the strain was Lactobacillus plantarum. 植物乳杆菌LB-1的基因序列具体为:GCTCAGGACGAACGCTGGCGGCGTGCCTAATACATGCAAGTCGAACGAACTCTGGTATTGATTGGTGCTTGCATCATGATTTACATTTGAGTGAGTGGCGAACTGGTGAGTAACACGTGGGAAACCTGCCCAGAAGCGGGGGATAACACCTGGAAACAGATGCTAATACCGCATAACAACTTGGACCGCATGGTCCGAGCTTGAAAGATGGCTTCGGCTATCACTTTTGGATGGTCCCGCGG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides plant bacterium lacticum LB-1 and an application thereof, and belongs to the technical field of microorganisms and food fermentation. The preservation No. of the plant bacteriumlacticum LB-1 is CGMCC NO.18215. The plant bacterium lacticum LB-1 has high restraining effects on blue mould, aspergillus niger, aspergillus flavus, sspergillus ochraceus, aspergillus fumigatus andfusarium graminearum, and the shelf life of whole wheat bread can be prolonged. The plant bacterium lacticum LB-1 and the yeast are in cooperation fermentation, so that the vicoelasticity, the ductibility and the water retention property of whole wheat dough in the fermentation process can be notably improved, and the whole wheat sour dough has good processing quality. The plant bacterium lacticumLB-1 can improve crude mouth feel of the whole wheat bread, the hardness, the gumminess and the chewiness of the whole wheat bread can be reduced, and flavor components of the whole wheat bread can be increased, so that the made whole wheat bread conforms to taste of consumers.

Description

technical field [0001] The invention relates to the technical field of microorganisms and food fermentation, in particular to a strain of Lactobacillus plantarum LB-1 and its application. Background technique [0002] Lactic acid bacteria are a type of non-spore-forming Gram-positive bacteria that ferment sugars and mainly produce lactic acid. They are often used in the processing of fermented dairy products, fruit, vegetable and grain products, fermented meat products and seasoning production. Therefore, lactic acid bacteria have great application value in the food fermentation industry. [0003] Whole-wheat bread is bread made from whole-wheat flour without removing the bran and germ. Whole-wheat bread is rich in dietary fiber, minerals, protein, antioxidants and vitamins, but due to its high content of crude fiber and fatty acids, it may lead to poor processing performance of whole-wheat dough, mold contamination of whole-wheat bread and poor taste . At present, the ap...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/20A21D8/04A21D13/06C12R1/25
CPCA21D8/04A21D13/06C12N1/20C12N1/205C12R2001/25
Inventor裴斐孙磊胡秋辉方勇杨文建李彭李向菲
OwnerNANJING UNIV OF FINANCE & ECONOMICS