Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Kit for detecting medicinal effect of warfarin by utilizing rs9934438

A kit and primer set technology, applied in the field of genetics, can solve the problems of lack of anticoagulant treatment effect, large inter-individual differences, narrow treatment window, etc., and achieve the effects of fast speed, low false positives, and reduced pollution

Inactive Publication Date: 2019-12-20
SHANGHAI JIAO TONG UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

A large number of clinical studies have shown that warfarin has the advantages of a wide range of indications and low price, but at the same time, the solution to the defect of large inter-individual differences caused by a narrow therapeutic window is also a hot spot in social research today.
Due to differences in drug sensitivity among individuals and different requirements for drug dosage, clinicians usually adjust drug dosage based on personal experience and patients' clinical phenotype, which is obviously unreasonable, so this has also become a problem encountered in the process of warfarin medication. The most difficult problem: taking the best drug effect dose as the baseline, if the given dose is small, the effect of anticoagulant treatment will not be achieved and cause thrombus, and if the given dose is too high, severe bleeding events will be caused by excessive anticoagulation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Kit for detecting medicinal effect of warfarin by utilizing rs9934438

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1, primer design and synthesis

[0032] Design corresponding specific PCR primer sequences (SEQ ID No:1 to SEQ ID No:2) and specific extension primer sequences (SEQ ID No:3) for VKORC1rs9934438 gene polymorphism sites related to warfarin medication; The specific sequence is shown in Table 1:

[0033] Table 1

[0034] serial number target site sequence (5'-3') use SEQ ID NO:1 rs9934438 ACGTTGGATGGTGATTTCCAAGAAGCCACC PCR forward primer SEQ ID NO:2 rs9934438 ACGTTGGATGAGATGAAAAGCAGGGCCTAC PCR reverse primer SEQ ID NO:3 rs9934438 GTGCCAGGAGATCATCGAC extension primer

Embodiment 2

[0035] Embodiment 2, sample DNA extraction

[0036] 5 ml of blood drawn were collected in vacutainer tubes containing 3.2% trisodium citrate and lithium heparin and allowed to stand for at least 6 hours. Invert blood collection tubes 3-5 times to ensure thorough mixing of blood and anticoagulant. use The DNA MiniKit (250) kit was used for DNA extraction; the determination of the DNA concentration was completed on the Thermo Fisher NanoDrop 2000 ultra-micro-volume UV spectrophotometer; when performing sample determination, it was necessary to record the three values ​​of concentration, 260 / 280 and 260 / 230, In order to find the possible cause of contamination so that the concentration does not reach the requirement, it is also required that the experimenter must aliquot the DNA sample so that the number of times of freezing and thawing the sample can be reduced during the experiment to ensure the high quality of the DNA. Then dilute the extracted sample concentration with d...

Embodiment 3

[0037] Embodiment 3, biological experiment

[0038] ABI 9700 PCR instrument was used to detect the genetic polymorphisms of VKORC1 gene and warfarin efficacy according to the instructions; the reagents involved are shown in Table 2:

[0039] Table 2

[0040] serial number Reagent main ingredient X sample size 1 PCR Primer Mix PCR primers 1*1.1X 2 PCR reaction solution Taq enzyme, dNTP, PCR buffer 4*1.1X 3 Enzyme digestion reaction solution SAP enzyme, SAP buffer 2*1.1X 4 Extension Primer Mix extension primer 0.94*1.1X 5 Extension reaction solution Termination mix, single base elongase 2*1.1X 6 Quality Control Samples Human Genomic DNA (20ng / μL) 1*1.1X

[0041] 1. PCR reaction conditions: 95°C, 2min; 45 cycles (95°C, 30s; 56°C, 30s; 72°C, 60s); 72°C, 5min.

[0042] 2. SAP digestion reaction conditions: 37°C, 40min; 85°C, 5min.

[0043] 3. UEP extension reaction conditions: 94°C, 30s; 40 external cycle...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a kit for detecting the medicinal effect of warfarin by utilizing rs9934438. The kit comprises a MassARRAY chip, and three primers for detecting the gene VKORC1rs9934438SNP site are respectively called as a forward primer, a reverse primer and an extension primer with the sequences respectively shown as SEQ ID No.1-3 in sequence, wherein the primers are polymorphic sites for identifying the medicinal effect of warfarin and adverse reaction related genes. The kit disclosed by the invention can be used for carrying out high-throughput detection on the sites and has the advantages of high sensitivity, high specificity, stable detection results, high reliability and the like; and meanwhile, the kit is suitable for the gene analysis fields of clinical disease mutation detection, pharmacogenomics analysis, medicolegal expertise and the like.

Description

technical field [0001] The invention belongs to the field of gene technology, and relates to a kit for detecting warfarin efficacy by using rs9934438. Background technique [0002] Warfarin is a dicoumarin derivative with a chemical structure of 3-(a-phenylacetone)-4-hydroxycoumarin. As a coumarin oral anticoagulant, warfarin is used to prevent and treat deep vein thrombosis and pulmonary embolism; prevent thromboembolic complications (stroke or systemic embolism) after myocardial infarction; prevent atrial fibrillation and cardiac valve disease Or thromboembolic complications caused by prosthetic valve replacement, its excretion is mainly through the kidney; however, in the liver, vitamin K participates in the warfarin metabolic pathway. The unactivated vitamin K-dependent blood coagulation factors II, VII, IX, X and proteins C, S, and Z in the body are only active after γ-carboxylation by γ-glutamyl carboxylase (GGCX), and then grade The chain reaction causes blood to co...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6883C12N15/11C12Q1/6858
CPCC12Q1/6858C12Q1/6883C12Q2600/106C12Q2600/118C12Q2600/156C12Q2531/113C12Q2533/101C12Q2565/627
Inventor 秦胜营张素丽李华葛均波贺林
Owner SHANGHAI JIAO TONG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com