Kit for detecting medicinal effect of warfarin by utilizing rs9934438
A kit and primer set technology, applied in the field of genetics, can solve the problems of lack of anticoagulant treatment effect, large inter-individual differences, narrow treatment window, etc., and achieve the effects of fast speed, low false positives, and reduced pollution
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Embodiment 1, primer design and synthesis
[0032] Design corresponding specific PCR primer sequences (SEQ ID No:1 to SEQ ID No:2) and specific extension primer sequences (SEQ ID No:3) for VKORC1rs9934438 gene polymorphism sites related to warfarin medication; The specific sequence is shown in Table 1:
[0033] Table 1
[0034] serial number target site sequence (5'-3') use SEQ ID NO:1 rs9934438 ACGTTGGATGGTGATTTCCAAGAAGCCACC PCR forward primer SEQ ID NO:2 rs9934438 ACGTTGGATGAGATGAAAAGCAGGGCCTAC PCR reverse primer SEQ ID NO:3 rs9934438 GTGCCAGGAGATCATCGAC extension primer
Embodiment 2
[0035] Embodiment 2, sample DNA extraction
[0036] 5 ml of blood drawn were collected in vacutainer tubes containing 3.2% trisodium citrate and lithium heparin and allowed to stand for at least 6 hours. Invert blood collection tubes 3-5 times to ensure thorough mixing of blood and anticoagulant. use The DNA MiniKit (250) kit was used for DNA extraction; the determination of the DNA concentration was completed on the Thermo Fisher NanoDrop 2000 ultra-micro-volume UV spectrophotometer; when performing sample determination, it was necessary to record the three values of concentration, 260 / 280 and 260 / 230, In order to find the possible cause of contamination so that the concentration does not reach the requirement, it is also required that the experimenter must aliquot the DNA sample so that the number of times of freezing and thawing the sample can be reduced during the experiment to ensure the high quality of the DNA. Then dilute the extracted sample concentration with d...
Embodiment 3
[0037] Embodiment 3, biological experiment
[0038] ABI 9700 PCR instrument was used to detect the genetic polymorphisms of VKORC1 gene and warfarin efficacy according to the instructions; the reagents involved are shown in Table 2:
[0039] Table 2
[0040] serial number Reagent main ingredient X sample size 1 PCR Primer Mix PCR primers 1*1.1X 2 PCR reaction solution Taq enzyme, dNTP, PCR buffer 4*1.1X 3 Enzyme digestion reaction solution SAP enzyme, SAP buffer 2*1.1X 4 Extension Primer Mix extension primer 0.94*1.1X 5 Extension reaction solution Termination mix, single base elongase 2*1.1X 6 Quality Control Samples Human Genomic DNA (20ng / μL) 1*1.1X
[0041] 1. PCR reaction conditions: 95°C, 2min; 45 cycles (95°C, 30s; 56°C, 30s; 72°C, 60s); 72°C, 5min.
[0042] 2. SAP digestion reaction conditions: 37°C, 40min; 85°C, 5min.
[0043] 3. UEP extension reaction conditions: 94°C, 30s; 40 external cycle...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 
