Alginate lyase and application thereof in quantitative detection of alginate
An algin lyase and quantitative detection technology are applied to the algin lyase and its application field in the quantitative detection of algin, and can solve the problems of cumbersome operation, high cost, poor method specificity and the like, and achieve fast enzymatic hydrolysis rate, The effect of excellent enzymatic properties and strong substrate binding specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0031] Example 1: Cloning, expression and acquisition of alginate lyase Aly7A in Escherichia coli
[0032] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers (5'-GATGACACCATATGCAAGAAAAGGCAAGTAGTACCACAGAAGTGG;
[0033] 5'-GACACGGATCCTTAATGTTTAACTTTTAACTTATAATAATTAACC), using the whole genome as a template for PCR, the PCR reaction conditions are: 95°C for 3min, 95°C for 20s, 42°C for 22s, 72°C for 60s, 22 cycles, and finally 72°C for 5min to obtain alginate cracking Enzyme Aly7A gene fragment. BamHI and NdeI double-digest the target gene and pET15b vector, and connect to form a recombinant plasmid. The recombinant plasmids were introduced into BL21(DE3) competent cells to form recombinant strains. The expression was induced by isopropyl thiogalactoside in LB medium containing ampicillin, the induction temperature was 17°C, and the induction time was 12h. ...
Embodiment 2
[0035] Example 2: Cloning, expression and acquisition of alginate lyase Aly7A in Pichia pastoris
[0036] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers according to the target gene (5'-ATTATTCGAAGGATCCTTAATGTTTAACTTTTAACTTATAATAATTAACCTTTGCAAAAGCTCCT;
[0037] 5'-CCGCCCTAGGGAATTCATGAATTACTTTAAAAAAGAATTTATACTTGTTGTAGTTATTTACTTTCC), using the whole genome as a template to carry out PCR as in Example 1 to obtain the alginate lyase Aly7A gene fragment. Use EcoRI and BamHI double enzymes to cut the target gene and pPIC9k plasmid, connect to form a recombinant plasmid, after Sac I digestion, directly add it to Pichia GS115 competent cells to form recombinant cells; after centrifugation, use 10mM pH8.0 N,N - Re-suspend the bacteria in bishydroxyethylglycine; spread the bacteria solution on the YPD plate containing ampicillin, culture it upside down at 30°C f...
Embodiment 3
[0038] Example 3: Cloning, expression and acquisition of alginate lyase Aly7A in Bacillus subtilis
[0039] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers according to the target gene (5'-AAAGGAGGAAGGATCCTTAATGTTTAACTTTTAACTTATAATAATTAACCTTTGCAAAAGCTCCT;
[0040] 5'-TAGGCGGGCTGCCCCGGGATGAATTACTTTAAAAAAGAATTTATACTTGTTGTAGTTATTTACTTTCC), using the whole genome as a template to perform PCR as in Example 1 to obtain the alginate lyase Aly7A gene fragment. BamHI and SacI double-digested target gene and pHT01 plasmid were ligated to form a recombinant plasmid, transformed into Bacillus subtilis competent cells, cultured at 37°C for 90 minutes, and spread to LB with chloramphenicol resistance on the tablet. Pick the positive clones containing the recombinant plasmid grown on the resistant plate and inoculate them in LB medium for 12 hours at 37°C, then inocu...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


