Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Alginate lyase and application thereof in quantitative detection of alginate

An algin lyase and quantitative detection technology are applied to the algin lyase and its application field in the quantitative detection of algin, and can solve the problems of cumbersome operation, high cost, poor method specificity and the like, and achieve fast enzymatic hydrolysis rate, The effect of excellent enzymatic properties and strong substrate binding specificity

Active Publication Date: 2020-03-24
OCEAN UNIV OF CHINA
View PDF7 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is that the quantitative detection method of alginate commonly used now has the problems of color development for polysaccharides containing uronic acid such as pectin and gum arabic, poor method specificity, or high cost and cumbersome operation, while alginate is cracked The completeness and specificity of enzymatic conversion of alginate will determine whether it can be used as an effective reactant for the quantitative detection of alginate

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alginate lyase and application thereof in quantitative detection of alginate
  • Alginate lyase and application thereof in quantitative detection of alginate
  • Alginate lyase and application thereof in quantitative detection of alginate

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1: Cloning, expression and acquisition of alginate lyase Aly7A in Escherichia coli

[0032] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers (5'-GATGACACCATATGCAAGAAAAGGCAAGTAGTACCACAGAAGTGG;

[0033] 5'-GACACGGATCCTTAATGTTTAACTTTTAACTTATAATAATTAACC), using the whole genome as a template for PCR, the PCR reaction conditions are: 95°C for 3min, 95°C for 20s, 42°C for 22s, 72°C for 60s, 22 cycles, and finally 72°C for 5min to obtain alginate cracking Enzyme Aly7A gene fragment. BamHI and NdeI double-digest the target gene and pET15b vector, and connect to form a recombinant plasmid. The recombinant plasmids were introduced into BL21(DE3) competent cells to form recombinant strains. The expression was induced by isopropyl thiogalactoside in LB medium containing ampicillin, the induction temperature was 17°C, and the induction time was 12h. ...

Embodiment 2

[0035] Example 2: Cloning, expression and acquisition of alginate lyase Aly7A in Pichia pastoris

[0036] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers according to the target gene (5'-ATTATTCGAAGGATCCTTAATGTTTAACTTTTAACTTATAATAATTAACCTTTGCAAAAGCTCCT;

[0037] 5'-CCGCCCTAGGGAATTCATGAATTACTTTAAAAAAGAATTTATACTTGTTGTAGTTATTTACTTTCC), using the whole genome as a template to carry out PCR as in Example 1 to obtain the alginate lyase Aly7A gene fragment. Use EcoRI and BamHI double enzymes to cut the target gene and pPIC9k plasmid, connect to form a recombinant plasmid, after Sac I digestion, directly add it to Pichia GS115 competent cells to form recombinant cells; after centrifugation, use 10mM pH8.0 N,N - Re-suspend the bacteria in bishydroxyethylglycine; spread the bacteria solution on the YPD plate containing ampicillin, culture it upside down at 30°C f...

Embodiment 3

[0038] Example 3: Cloning, expression and acquisition of alginate lyase Aly7A in Bacillus subtilis

[0039] Cultivation of Wenyingzhuangia fucanilytica CZ1127 in 2216E Medium T Until the end of the logarithm and extract the whole genome DNA, design upstream and downstream primers according to the target gene (5'-AAAGGAGGAAGGATCCTTAATGTTTAACTTTTAACTTATAATAATTAACCTTTGCAAAAGCTCCT;

[0040] 5'-TAGGCGGGCTGCCCCGGGATGAATTACTTTAAAAAAGAATTTATACTTGTTGTAGTTATTTACTTTCC), using the whole genome as a template to perform PCR as in Example 1 to obtain the alginate lyase Aly7A gene fragment. BamHI and SacI double-digested target gene and pHT01 plasmid were ligated to form a recombinant plasmid, transformed into Bacillus subtilis competent cells, cultured at 37°C for 90 minutes, and spread to LB with chloramphenicol resistance on the tablet. Pick the positive clones containing the recombinant plasmid grown on the resistant plate and inoculate them in LB medium for 12 hours at 37°C, then inocu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biotechnology and biochemical detection, and in particular relates to alginate lyase and an application thereof in quantitative detection of alginate. The alginate lyase Aly7A has a novel amino acid sequence and good enzymatic properties, and the amino acid sequence of the alginate lyase Aly7A is SEQ ID NO. 1. On the basis of Aly7A, the invention discloses a quantitative detection method of alginate. The method comprises the steps that alginate lyase Aly7A and a sample to be detected are subjected to mixed reaction; alginate possibly contained inthe sample is subjected to enzymolysis; the increment of the light absorption value of a reaction system at 235 nm is detected and substituted into a standard curve; and the content of alginate in the sample to be detected can be detected. The detection method has the advantages of being high in specificity, rapid, easy and convenient to implement and the like.

Description

technical field [0001] The invention relates to the technical fields of biotechnology and biochemical detection, in particular to an alginate lyase and its application in the quantitative detection of alginate. Background technique [0002] Alginate is an important class of linear polymer marine polysaccharides, composed of α-L-guluronic acid and β-D-mannuronic acid connected by β-1,4 glycosidic bonds, mainly found in kelp, horsetail Among large brown algae such as algae, the common product forms include sodium alginate, potassium alginate and calcium alginate, etc., because of their good gelling and plasticity, they are widely used as food additives in ice cream, bread, jelly, beer, dried noodles In the industrial production of food and so on. Alginate is a soluble dietary fiber. Several studies have shown that alginate can promote gastrointestinal motility, improve intestinal flora, and have physiological activities such as lowering blood lipids and promoting growth, show...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/80C12N15/60G01N21/33
CPCC12N9/80G01N21/33C12Y402/02011
Inventor 曹斯琦常耀光薛长湖裴晓洁张玉莹申晶晶王玉明李兆杰唐庆娟
Owner OCEAN UNIV OF CHINA
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com