Recombinant filamentous fungus for producing ethanol as well as construction and application of recombinant filamentous fungus

A filamentous fungus, ethanol technology, applied in the fields of genetic engineering and biology, can solve the problems of low ethanol production

Active Publication Date: 2021-06-25
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF11 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the ethanol yields of wild-type filamentous fungi (including Myceliophthora thermophila) are low and cannot be directly used for the actual production of ethanol.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant filamentous fungus for producing ethanol as well as construction and application of recombinant filamentous fungus
  • Recombinant filamentous fungus for producing ethanol as well as construction and application of recombinant filamentous fungus
  • Recombinant filamentous fungus for producing ethanol as well as construction and application of recombinant filamentous fungus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0055] Example 1 Overexpression of alcohol dehydrogenase encoding gene Scadh1 in Myceliophthora thermophila

[0056] 1. Construction of Scadh1 overexpression vector (pAN52-Scadh1)

[0057] An expression vector was constructed with pAN52-TB-Intron (Environ Microbiol.015.17(4):1444-62) as the backbone, and the eIF-5A gene (Mycth_2297659, Gene ID: 11511639) promoter PeIF fragment (sequence as shown in SEQ ID NO.1 shown), and inserted into the linearized vector pAN52-TB-Intron digested with BglII and SpeI to obtain the recombinant plasmid pAN52-PeIF-TtrpC-neo. Then use the primer eIF-ScADH1-F / R to amplify the Scadh1 (Gene ID: 854068) fragment of the alcohol dehydrogenase coding gene from S. The excised linearized vector pAN52-PeIF-TtrpC-neo was obtained to obtain the expression vector pAN52-PeIF-Scadh1 of the alcohol dehydrogenase coding gene Scadh1 regulated by the constitutive strong promoter PeIF.

[0058] The PCR reaction system is: Max Buffer 25μL, 10mM dNTPs 1μL, upstrea...

Embodiment 2

[0093] Example 2 Overexpression of pyruvate decarboxylase gene pdc1 in Myceliophthora thermophila

[0094] 1. Construction of pdc1 overexpression vector (pAN52-pdc1)

[0095] Using Saccharomyces cerevisiae S288C (taxid: 559292) genomic DNA as a template, the pdc1 gene (Gene ID: 850733) was amplified, and the 1.175kb fragment (named as Ptef promoter) is the promoter (the nucleic acid sequence is shown in SEQ ID NO.2), and the above two fragments are recombined into the linearized vector pAN52-TB-Intron digested by XhoI and BamHI using Gibson Assembly of NEB, The recombinant expression plasmid pAN52-tef-pdc1 ​​of pdc1 gene was obtained.

[0096] The PCR reaction system and reaction conditions in this example are the same as those described in Example 1 for vector construction.

[0097] The primers used in the vector construction in this example are as follows:

[0098] SEQ ID NO. Primer Sequence (5'-3') 72 pdc1-Gib-Ptef-F TACCGTCAAAAATGTCTGAAATTACTTTGGG ...

Embodiment 3

[0103] Example 3 Overexpression of the glucose transporter / hexose transporter encoding gene glt-1 in Myceliophthora thermophila

[0104] 1. Glucose transporter gene glt-1 expression vector construction

[0105] The glufosinate-resistant gene (bar) fragment PtrpC-bar and the TrpC terminator fragment TtrpC under the regulation of the TrpC promoter were recombined into the linearized vector pCAMBIA-0380 after digestion with BglII using the Gibson Assembly of NEB to obtain The bar gene expression vector p0380-P-bar-T under the control of the promoter TrpC.

[0106] Glucose transporter gene glt-1 (NCU01633, GeneID: 3872148) was amplified from Neurospora crassa genome, and a 1372bp fragment upstream of the gene gpdA (Mycth_2311855) encoding glyceraldehyde-3-phosphate dehydrogenase from Myceliophthora thermophila (as shown in SEQ ID NO.6) as a promoter, with the downstream fragment TcbhI of Myceliophthora thermophila cellobiohydrolase encoding gene cbh-1 (Mycth_109566) as a terminat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a construction method of genetically engineered bacteria of filamentous fungi, which is characterized in that the filamentous fungi overexpresses ethanol synthesis positive regulatory genes and / or down-regulates endogenous ethanol synthesis negative regulatory genes through a genetic engineering method to obtain the genetically engineered bacteria. Compared with an original strain, the obtained genetically engineered bacteria has the advantage that the ethanol synthesis capability is improved.

Description

technical field [0001] The invention belongs to the fields of genetic engineering and biotechnology. Specifically, the present invention relates to a method for constructing a recombinant engineering bacterial strain for producing ethanol and the obtained recombinant engineering bacterial strain. The invention also relates to a method for producing ethanol by said recombinant engineered bacteria. Background technique [0002] With the rapid development of the world economy, human beings' demand for energy is increasing day by day. On the one hand, the currently used fossil energy such as oil has limited reserves, and it will produce a lot of pollution during the combustion process. Energy and environmental issues have become a major challenge to human development. The transportation industry is a major sector of energy consumption and an important source of greenhouse gas emissions, so there is an urgent need to develop clean, renewable alternative fuels. Among them, fuel...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12P7/06C12P7/10C12R1/645
CPCC12N9/0006C12N9/80C12N9/0016C07K14/395C12P7/06C12P7/10C12Y101/01001C12Y401/01001C12Y104/01014Y02E50/10
Inventor田朝光张永利李金阳李金根孙涛刘倩孙文良
OwnerTIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI