Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

GPI anchoring protein expression system containing selenocysteine and cell with high-expression of recombinant protein

A selenocysteine ​​and anchoring protein technology, applied in the direction of genetically modified cells, peptides containing affinity tags, peptides containing His tags, etc., can solve problems such as darkening of nails and skin, hair loss, etc., to achieve Simplify the difficulty and filter the effect of convenience

Pending Publication Date: 2022-01-14
JIANGNAN UNIV
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Long-term overdose of selenium can lead to hair loss, darkening of nails and skin, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • GPI anchoring protein expression system containing selenocysteine and cell with high-expression of recombinant protein
  • GPI anchoring protein expression system containing selenocysteine and cell with high-expression of recombinant protein
  • GPI anchoring protein expression system containing selenocysteine and cell with high-expression of recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Construction of a GPI-anchored protein expression system containing selenocysteine ​​(taking recombinant lysosomal acid lipase (LIPA) as an example) by combining the oxidoreductase protein family selenocysteine ​​and GPI Ankyrin synthesis features are constructed.

[0033] Prepare the vector: prepare the vector pME-Puro-sHF-GPI, which has a puromycin resistance gene (Puro), a his and Flag tag gene (sHF) with a signal peptide, and a GPI modified signal sequence;

[0034] The pME-Puro-sHF-GPI was connected to LIPA (lysosomal acid lipase) by In-fusion homologous recombination to generate the plasmid pME-Puro-ssHF-LIPA-GPI, and the stop codon UGA (in the environment containing selenium The codon for the expressive selenocysteine ​​Sec below) was inserted before the GPI attachment signal sequence of pME-Puro-sHF-LIPA-GPI (sHF represents the endoplasmic reticulum signal sequence plus the His6-FLAG-tag ) by site-directed mutagenesis of CTAATGAGGAAATATCAGTGACTCGAGAATGGTGGGACA ...

Embodiment 2

[0042] Construction of a system for removing the PIGK gene: First, the PIGK (a catalytic subunit of the GPI-anchored protein transamidase complex) gene was knocked into HEK293 cells using the CRISPR / Cas9 system. BbsI cut the vector pX330-EGFP (purchased from Addgen, purchase link https: / / www.addgene.org / 42230 / ). The PIGK-KO target sequence group caccGCTCTTGTCCTTCGGCAGCGTGG and aaacCCACGCTGCCGAAGGACAAGAGC were ligated into the digested pX330-EGFP to generate pX330-EGFP-PIGK-KO, and the protein produced by the plasmid knocked out of the PIGK gene could not be anchored by GPI after transfection into cells modified, all secreted into the culture medium and become soluble proteins. After transfection, cells with EGFP were sorted with a cell sorter S3 (Bio-Rad Laboratories). The collected cells were cultured for 7 days or more and subjected to limiting dilution to obtain clonal KO cells. The clone without WT allele was selected, and the DNA sequence was analyzed by sequencing. The...

Embodiment 3

[0050] Validation of elimination of GPI-form recombinant proteins by knocking out the PIGK gene: Even though we obtained cell lines highly expressing recombinant proteins using the GPS system, some recombinant proteins were expressed on the cell surface in the form of GPI-AP. When administered as a drug, the small fraction of GPI-anchored forms may affect protein properties such as activity and immunogenicity. We therefore next attempted to eliminate the GPI-anchored form from cells.

[0051] For this purpose, we established cell lines that can regulate the expression of the GPI biosynthesis gene PIGK. Deletion of endogenous PIGK from HEK293 cells resulted in loss of GPI-AP expression (attached image 3 A). Then, a cassette containing the PIGK gene fragment and the puroΔTK gene flanked by FRT sites and PB transposon recognition sites was reinserted into the genome to restore GPI-AP expression in the rescued cells. In this system, PIGK can be excluded by FLP recombinase or P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a GPI anchoring protein expression system and a cell with high-expression of recombinant protein. The system is prepared by the steps of preparing a carrier, connecting a specific protein, carrying out site-specific mutagenesis, inserting SECIS and replacing to pME-Hyg. The system can induce soluble recombinant protein to be expressed on the surface of a cell membrane in the form of GPI anchoring protein or secreted into a culture medium in the form of soluble protein by utilizing a selenium element. Under the condition that no selenium element is added, the recombinant protein is secreted into a culture medium, so that a cell strain with high expression of the recombinant protein is obtained, and the system greatly simplifies the difficulty of detecting and screening high expression cells. Compared with other screening systems, the system expresses the recombinant soluble protein on the surface of a cell membrane, and the screening is convenient and efficient by utilizing flow sorting.

Description

technical field [0001] The invention relates to the technical field of cell engineering, in particular to a GPI-anchored protein expression system containing selenocysteine ​​and cells highly expressing recombinant proteins. Background technique [0002] Production of recombinant proteins using mammalian cells has received increasing attention as they are increasingly used in biopharmaceuticals and clinical research. Mammalian cell lines, such as Chinese hamster ovary cells (CHO), baby hamster kidney cells, mouse myeloma cells, and human embryonic kidney 293 (HEK293) cells, have been investigated due to their proper protein folding, assembly, and post-translational modification capabilities. Widely used in the production of recombinant proteins. In recent years, the demand for pharmaceutical proteins has increased year by year. At present, the increase in productivity is mainly through the improvement of gene transfection efficiency and gene amplification rate, host cell en...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/85C12N15/62C12N15/54C12N15/11C12N5/10
CPCC12N15/85C12N9/20C12N9/2465C12N9/1096C12N5/0603C12N5/0686C12Y301/01003C12Y302/01022C12N2800/107C07K2319/035C07K2319/02C07K2319/21C12N2510/02
Inventor 藤田盛久柳艺石
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com