Animal-derived live virus quantitative detection method

A quantitative detection method and live virus technology, which is applied in the determination/inspection of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problems affecting the accuracy, eliminate the impact, improve the detection efficiency and sensitivity high effect

Pending Publication Date: 2022-04-15
RINGPU (BAODING) BIOLOGICAL PHARMACEUTICAL CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In recent years, ethidium azide bromide has been applied to the detection of viruses, but there are still some problems in the application of this technology
After the virus is inactivated, there are non-infectious virus particles for a long time, and the nucleic acid is wrapped by nucleocapsid protein, envelope protein, etc., and ethidium azide bromide cannot bind to these unexposed nucleic acids. The above-mentioned inactivated viral nucleic acid It will affect the accuracy of PCR detection, so a real-time fluorescence quantitative PCR detection method that can distinguish live virus from inactivated virus is needed to achieve quantitative detection of live virus of animal origin

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Animal-derived live virus quantitative detection method
  • Animal-derived live virus quantitative detection method
  • Animal-derived live virus quantitative detection method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Quantitative Detection of Fowl Pox Virus

[0035] 1. Design and synthesis of primers and probes for fowlpox virus detection

[0036] The present invention refers to the fowlpox virus core protein 4b gene sequence published by GenBank, designs a pair of specific primers and probes, and amplifies a fragment of 127 bp.

[0037] FVP-1-F: CAACGGTATTACATATCTACTAA

[0038] FVP-1-R: CGTGAATAGAATAGTATAGTATCC

[0039] FVP-1-probe: FAM-ATACATCTCCGCCGTCGCAA-BHQ1

[0040] 2. Specific verification of primers and probes

[0041] The virus fluids of fowlpox virus, Newcastle disease virus, chicken infectious bursal virus, chicken infectious laryngotracheitis virus and chicken Marek's disease virus were used as templates respectively (the virus fluids were all from Ringpu (Baoding) Biopharmaceutical Co., Ltd. Live vaccine for poultry of the company (available on the market), DNA-free water as a blank control, chicken embryo allantoic fluid as a negative control, and a comme...

Embodiment 2

[0066] Example 2 Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) Quantitative Detection

[0067] 1. Design and synthesis of primers and probes for PRRSV detection

[0068] The present invention refers to the fowlpox virus PRRSV ORF6 M gene sequence published by GenBank, designs a pair of specific primers and probes, and amplifies a fragment of 118 bp.

[0069] PRRSV-1-F:CCACAAAAGGTGCTTTTG

[0070] PRRSV-1-R CACAGTTCAGGAAGATCA

[0071] PRRSV-1-probe: FAM-TTCCATTACCTATACGCCAGTGATGAT-BHQ1

[0072] 2. Take the PRRSV virus liquid sample to be tested (the virus liquid comes from the Porcine Reproductive and Respiratory Syndrome Virus Live Vaccine (R98 strain) of Ringpu (Baoding) Biopharmaceutical Co., Ltd., available in the market) and add a final concentration of 100 μmol / mL stacked Ethidium nitrogen bromide solution; placed on a shaker at room temperature, protected from light, incubated and shaken at 100rpm for 20 minutes, to allow ethidium azide bromide to fully b...

Embodiment 3

[0078] Detect chicken infectious bursal virus according to embodiment 2 method, and it and chicken embryo half infectious dose method (EID 50 ) test result statistics, the result shows that the detection method of the present invention is linearly related to the chicken embryo half infection dose method (EID50) test result.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses an animal-derived live virus quantitative detection method, which belongs to the technical field of biology, and comprises the following steps: a, treating a virus liquid sample to be detected by adopting ethidium azide bromide; b, further treating by adopting an isoelectric precipitation method, and taking supernate for later use; c, taking supernate, and extracting viral nucleic acid; and d, carrying out viral nucleic acid PCR detection by adopting real-time fluorescent quantitative PCR, and calculating the content of live viruses in the to-be-detected virus liquid sample according to an amplification curve Ct value. The animal-derived live virus fluorescent quantitative PCR detection method has the advantages of high sensitivity, strong specificity, high accuracy, short detection period and the like, overcomes the defects of the existing detection method, and meets the requirement of virus content detection in veterinary biological product production.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a quantitative detection method for animal source live viruses. Background technique [0002] In the experimental research of animal-derived viruses and the production of biological products, it is often necessary to quantitatively detect the virus content. Commonly used detection methods include chicken embryo half infection dose method, cell half infection dose method, animal half infection dose method, virus plaque method, Methods such as indirect immunofluorescence method and hemagglutination test method, but the above methods generally have problems such as many influencing factors and low accuracy. [0003] Real-time fluorescence quantitative PCR technology has been applied to the quantitative detection of bacteria, viruses and other microorganisms, with strong sensitivity and good specificity. However, due to changes in the environmental physical and chemical values ​​and tem...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/70C12Q1/6851C12N15/11
Inventor 刘云涛刘涛郁宏伟吴雅清李建丽柳珊张新新赵丽霞刘茜王幸
Owner RINGPU (BAODING) BIOLOGICAL PHARMACEUTICAL CO LTD
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap