Check patentability & draft patents in minutes with Patsnap Eureka AI!

Lactobacillus fermentum for inhibiting helicobacter pylori and application thereof

A technology for fermenting Lactobacillus and Helicobacter pylori, applied in the field of probiotics, can solve the problems of high recurrence rate, long course of disease, difficult to cure completely, etc., and achieves the effect of broad application prospects and avoiding environmental pollution

Active Publication Date: 2022-06-07
CHINA AGRI UNIV
View PDF17 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Gastric ulcer is a common clinical chronic digestive system disease with a long course of disease, high recurrence rate and difficult to cure completely

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Lactobacillus fermentum for inhibiting helicobacter pylori and application thereof
  • Lactobacillus fermentum for inhibiting helicobacter pylori and application thereof
  • Lactobacillus fermentum for inhibiting helicobacter pylori and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Microbial culture preparation

[0030] Preparation of Lactobacillus fermentedii of the present invention: After two generations of activation of Lactobacillus fermented in MRS medium, inoculated in MRS liquid medium at a 2% inoculation amount for 12 h, centrifugation (4000 rpm, 10 min) to remove the supernatant, after cleaning the body twice with PBS, during gastric lavage, resuspended in 0.9% normal saline and adjusted its bacterial suspension concentration to 1×10 9 CFU / mL。

[0031]Helicobacter pylori was activated on a Colombian blood agar plate, the body was scraped off and washed twice with PBS, then transferred to cerebral heart immersion medium (BHI) containing 5% fetal bovine serum, and the concentration of the bacterial fluid was adjusted to 1×10 after continuing to culture under microaerobic conditions for 48 h 9 CFU / mL and immediately perform an irrigation experiment.

[0032] Lactobacillus fermented with fermented Lactobacillus supernatant: Lactobacill...

Embodiment 2

[0033] Example 2 Animal model

[0034] The experimental animals were selected from SPF-grade C57BL / 6N (5-week-old, female) mice purchased from Beijing Victory Hua Experimental Animal Technology Co., Ltd. Animal experiments were divided into 6 groups, namely blank group, model group, drug group, LFE-55 high dose group, LFE-55 low dose group, LFE-55 supernatant group, each group of 8 mice, a total of 48.

[0035] Mouse feeding conditions: temperature 24 °C, control light for 12 h, dark for 12 h, change the bedding every three days. After one week of adaptive rearing, the gastric mixture of antibiotics (5 mg ampicillin, 1 mg gentamicin sulfate, 5 mg azithromycin) per mouse per day is emptied for 3 days and weighed once a week.

[0036] The blank group was first fed 0.25 mL NaHCO 3 (0.2 mol / L), after 1 h, analytic 0.3 mL BHI medium, every other day, 5 times;

[0037] Model group and intervention group: 0.25 mL NaHCO for gastric first 3 (0.2 mol / L), after 1 h, the concentration of 0.3 ...

Embodiment 3

[0039] Example 3 Detection of virulence factor CagA and VacA

[0040] Expression of virulence factor CagA and VacA: gastric tissue RNA was extracted using the kit, and reverse transcription of RNA was used to cDNA, with cDNA as a template, PCR amplification was carried out, the primer sequence was: CagA upstream primer ATATGCTAAATTAGACAACTTGAGCGA, downstream primer TTAGAATAATCAACAAACATCACAGCGCCAT; VacA upstream primer CTGGAGCCGGGAGGAAAG, downstream primer GGCGCCATCATAAagaGAAATTT. PcR reaction system total 20 μL: cDNA template 2 μL, SYBR Green PCR Master Mix 10 μL, upstream and downstream primers 0.5 μL each, nucleic acid-free water 7 μL; The reaction conditions were: 95 °C for 5 min, 95 °C for 15s, 60 °C for 1 min, a total of 35 cycles. With GADPH as the internal reference, 2 is used -△△Ct The method calculates the relative expression of the gene of interest and repeats it three times.

[0041] CagA mRNA expression levels in each group of mouse gastric tissues were as follows Figu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides lactobacillus fermentum for inhibiting helicobacter pylori and application of the lactobacillus fermentum. The preservation number of the lactobacillus fermentum is CGMCC NO.23590, and the lactobacillus fermentum has the effect of inhibiting mice from being infected with the helicobacter pylori. The lactobacillus fermentum LFE-5 can inhibit the growth and colonization of helicobacter pylori by reducing the relative abundance of harmful bacteria such as helicobacter pylori, bacteroides and devulcanivibrio in gastric tissues of mice infected with helicobacter pylori and increasing the relative abundance of beneficial bacteria such as AKKermansia and lactic acid bacteria, and can significantly reduce the mRNA expression level of helicobacter pylori virulence factors such as CagA and VagA.

Description

Technical field [0001] The present invention belongs to the field of probiotic technology, particularly relates to a kind of fermented Lactobacillus pylori having an inhibitory effect on Helicobacter pylori and its applications. Background [0002] Helicobacter pylori (Hp), a gram-negative microaerobic bacterium colonized in the human gastric mucosa, is the main causative factor of chronic gastritis, peptic ulcer, gastric mucosal-associated lymphoid tissue lymphoma and gastric cancer. Studies have shown that Hp has a clear correlation with the occurrence and development of gastric ulcers, and more than 80% of gastric ulcers are caused by Hp infection. Gastric ulcer is a common chronic digestive disease in the clinic, with a long course, high recurrence rate and difficult to completely cure. Eradication of Hp is the key to the treatment of gastric ulcers, and can promote the healing of gastric ulcers and significantly reduce the recurrence rate of ulcers. [0003] With the increas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A61K35/747A61P31/04A23L33/135C12R1/225
CPCC12N1/20A61K35/747A61P31/04A23L33/135A23V2002/00A23V2200/30Y02A50/30
Inventor 王然赵宇阳任发政李依璇何晶晶詹菁张琪
Owner CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More