Thermostable beta-galactosidase and application thereof in synthesis of glycerol galactoside

A technology of β-galactosidase and expression vector, which is applied in the application field of heat-stable β-galactosidase and its synthesis of glycerol galactoside, can solve the problems of complex product components, increased purification burden, and low reaction cost, and achieve Effect of high reaction temperature, good tolerance and long reaction time

Pending Publication Date: 2022-07-22
NANJING UNIV OF TECH +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The transglycoside synthesis usually uses agricultural waste lactose as the glycosyl donor, and the reaction cost is low, but lactose can also be used as the glycosyl acceptor to synthesize galacto-oligosaccharides, resulting in complex product components and increasing the burden of purification
Wei Wei et al. (Synthesis and characterization of galactosyl glycerol by b-galactosidasecatalysed reverse hydrolysis of galactose and glycerol), disclosed the use of galactosidase derived from Kluyveromyces lactis to synthesize glycerol galactose by reverse hydrolysis of galactose and glycerol as substrates Glycosides, under the optimal reaction conditions at a temperature of 40°C, the yield of glycerol galactoside reaches 116.47mg / ml (galactose conversion rate 55.88%), but the amount of enzyme used in its synthesis system is very large, reaching 240U / ml, and 40 There is a risk of bacterial contamination at the reaction temperature of ℃

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Thermostable beta-galactosidase and application thereof in synthesis of glycerol galactoside
  • Thermostable beta-galactosidase and application thereof in synthesis of glycerol galactoside
  • Thermostable beta-galactosidase and application thereof in synthesis of glycerol galactoside

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Construction of engineering bacteria for expressing galactosidase

[0023] The β-galactosidase source strain of the present invention is Bifidobacterium thermophilum NJ-5, and its amino acid sequence is shown in SEQ ID NO: 1. In order to improve the protein expression, a recombinant Escherichia coli expression vector is constructed.

[0024] Using strain Bifidobacterium thermophilum NJ-5 genomic DNA as template, high-fidelity enzyme 2 × Phanta Max Master Mix (Nanjing Novizan Biotechnology Co., Ltd.), and primer pair B-F (5′CG GGATCC ATGACAGCACGCAGAACACATCG 3', BamH I, SEQ ID NO: 3) and B-R (5' CCG CTCGAG TCAACCCATGCTGACGATGACG 3'Xho I, SEQ ID NO: 4) was used for PCR amplification, and the experimental operation was referred to Vazyme biological products and operation manual. For nucleic acid electrophoresis of PCR products, see figure 1 , the DNA fragment of the coding gene obtained by amplification should be 2000bp, and the nucleic acid electrophoresis ve...

Embodiment 2

[0027] Example 2 Expression of β-galactosidase BtGal42 in Escherichia coli

[0028] The recombinant strain constructed in Example 1 was inoculated into 50 mL of LB liquid medium containing 100 μg / mL kanamycin sulfate, and cultured at 37° C. at 180 rpm overnight; the seed liquid was inoculated into fresh 50mL of LB liquid medium, 37°C, 180rpm to OD 600 When the temperature is 0.6 to 1.0, take it out and cool it in an ice-water bath for 5 min, add the inducer IPTG (isopropyl-β-D thiogalactoside) (final concentration 0.5 mmol / L), and induce expression for 20 h at 20 °C and 150 rpm.

[0029] Take the induced expression fermentation broth, centrifuge at 12000rpm for 20min, discard the supernatant, and then use 50mM Na 2 HPO 4 -KH 2 PO 4(pH 7.0) buffer, resuspend and wash the cells, centrifuge at 12,000 rpm for 20 min, discard the supernatant, resuspend with buffer, and then sonicate. The broken liquid was centrifuged at 12000rpm for 20min, and the supernatant was taken for SDS...

Embodiment 3

[0031] Example 3 Determination procedure of galactosidase BtGal42 enzymatic activity

[0032] The recombinant strain constructed in Example 1 was fermented and cultivated according to the method of Example 2, and the obtained crude protein enzyme liquid was measured with β-oNPG as a substrate to measure the change of enzyme activity, and the measurement method was as follows:

[0033] Definition of enzyme activity unit: One enzyme activity unit is the amount of enzyme required to catalyze the hydrolysis of β-oNPG to generate 1 μmol oNP per minute at 50°C and pH 7.0.

[0034] Accurately weigh 30 mg of β-oNPG and dissolve it in 10 mL of Na 2 HPO 4 -KH 2 PO 4 Buffer (50mM, pH 7.0), stir and mix to obtain a substrate solution with a concentration of 10mmol / L. Accurately pipette 240 μl of the substrate solution into a 96-well plate, add 10 μl of appropriately diluted enzyme solution, take the inactivated enzyme reaction solution as a control, and react at 50 °C for 10 min, and ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides thermostable beta galactosidase and a related recombinant engineering strain thereof, and relates to the technical field of recombinase catalysis engineering. The beta galactosidase BtGal42 can be used for synthesizing glycerol galactoside by an enzymatic method at 50 DEG C by taking galactose as a glycosyl donor and taking glycerol as a glycosyl receptor, the enzyme stability is good at the temperature, and compared with the prior art, the use amount of the enzyme is obviously reduced, and the production cost is reduced. When the beta-galactosidase disclosed by the invention is used for a synthetic reaction, the bacterial contamination risk can be reduced and the reaction efficiency of a substrate can be improved by increasing the reaction temperature, so that the production efficiency of glyceryl galactoside is improved, and industrial application requirements can be completely met.

Description

technical field [0001] The invention belongs to the technical field of recombinase catalysis engineering, and in particular relates to a thermostable beta-galactosidase and its application for synthesizing glycerol galactoside. Background technique [0002] Glycerol galactoside is a natural small molecule alcohol-soluble galactoside with a wide range of uses, which is composed of galactosyl and glycerol, and is mostly found in red algae and red tide algae cells. Glycerol galactoside and its ester derivatives have interesting uses in food, cosmetics, health products and even antitumor drugs. Compared with monosaccharides with hemiacetal hydroxyl groups, glycerol galactoside has higher stability to environments such as strong acids and alkalis, and in algal cells, it can help the osmotic adaptation of cells and improve the antifreeze or heat resistance of cells. , helps cells withstand extreme environments. Because glycerol galactoside is biodegradable, has no toxic effect o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/38C12N15/56C12P19/44
CPCC12N9/2471C12Y302/01023C12P19/44
Inventor吴斌贾向飞郭嵩高振王毳何冰芳
OwnerNANJING UNIV OF TECH