Transgenic microbial polyhydroxyalkanoate producers

a technology of polyhydroxyalkanoate and transgenic bacteria, which is applied in the direction of transferases, lyases, enzymology, etc., can solve the problems of pha production of many of the microorganisms in these references that are not commercially useful, p(3hb) production by recombinant organisms is hampered, and the number of plasmid copy numbers is often decreased, so as to achieve the effect of pha production processes

Inactive Publication Date: 2005-08-04
METABOLIX
View PDF12 Cites 35 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Benefits of technology

"The patent text describes a way to create microbial strains that can produce PHA (a type of plastic) without the need for plasmids (which can cause problems in production processes). These strains also have a stable number of genes, resulting in consistent PHA production. The genes are integrated using standard techniques, and can be controlled based on different conditions. The strains can also be modified to make them resistant to antibiotics. Overall, this approach makes PHA production more efficient and reliable."

Problems solved by technology

PHA production by many of the microorganisms in these references is not commercially useful because of the complexity of the growth medium, the lengthy fermentation processes, or the difficulty of down-stream processing of the particular bacterial strain.
One of the challenges of producing P(3HB) in recombinant organisms is the stable and constant expression of the phb genes during fermentation.
Often P(3HB) production by recombinant organisms is hampered by the loss of plasmid from the majority of the bacterial population.
Such stability problems may be attributed to the metabolic load exerted by the need to replicate the plasmid and synthesize P(3HB), which diverts acetyl-CoA to P(3HB) rather than to biomass.
In addition, plasmid copy numbers often decrease upon continued fermentation because only a few copies provide the required antibiotic resistance or prevent cell death by maintaining parB.
Although this productivity is of the same order of magnitude as natural P(3HB) producers, strains harboring these parB-stabilized runaway replicons still lost the capacity to accumulate P(3HB) during prolonged fermentations.
While the instability of the phb genes in high cell-density fermentations affects the PHA cost by decreasing the cellular P(3HB) yields, the cost of the feedstock also contributes to the comparatively high price of PHAs.
However, overall PHB yield is still affected by loss of phb genes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transgenic microbial polyhydroxyalkanoate producers
  • Transgenic microbial polyhydroxyalkanoate producers
  • Transgenic microbial polyhydroxyalkanoate producers

Examples

Experimental program
Comparison scheme
Effect test

example 1

Host Strains and Plasmid Tools for Gene Integration

[0058] Strains and plasmids from which transposon vectors and transposon derivatives were developed are listed in Tables 2 and 3 below. MBX245 and MBX247 were selected by growing MBX23 and LS5218 respectively on LB plates containing approximately 30 g / ml naladixic acid. MBX246 and MBX248 were selected by growing MBX23 and LS5218, respectively, on LB plates containing 50 g / ml rifampicin. Colonies that appeared on these selective media within 24 hours were replica plated on the same medium and after growth stored in 15% glycerol / nutrient broth at −80° C.

[0059] MBX245 and MBX247 were selected by growing MBX23 and LS5218 respectively on LB plates containing 30 μg / ml naladixic acid. MBX246 and MBX248 were selected by growing MBX23 and LS5218 respectively on LB plates containing 50 μg / ml rifampicin. Colonies that appeared on these selective media within 24 hours were replica plated on the same medium and after growth stored in 15% glyce...

example 2

Construction of Cloning Vectors to Facilitate Integration of phb Genes

[0061] The plasmids pMNXTp1kan and pMNXTp1cat were based on the plasmids pUC18Not and pUC18Sfi and developed as shown in FIG. 1.

[0062] The Tn903 kanamycin (Km) resistance gene from plasmid pBGS18 was amplified by PCR using the oligonucleotide primers

linkK1,5′ TGCATGCGATATCAATTGTCCA GCCAGAAAGTGAGG,andlinkK2,5′ ATTTATTCAACAAAGCCGCC.

[0063] Prior to PCR amplification, the primers were phosphorylated using T4 polynucleotide kinase using standard procedures. The DNa was amplified using the following program: 1 cycle of 3 min at 95° C., 40 s at 42° C., 2 min at 72° C., followed by 30 cycles of 40 s at 95° C., 40 s at 42° C. and 90 s at 72° C. The DNA then was phenol extracted and treated with T4 DNA polymerase prior to gel purification. The blunt ended 0.8 kb DNA fragment was then inserted into the Ecl136II site in the polylinker of pUC18Not to obtain pMNXkan.

[0064] The cat gene was obtained as an HindIII cassette f...

example 3

Construction of Plasmids for Chromosomal Integration of phbC, Encoding PHB Polymerase

[0068] Plasmid pMUXC5cat contains the phbC gene from Z. ramigera on a transposable element for integration of this gene on the chromosome of a recipient strain, as shown in FIG. 2. Strong translational sequences were obtained from pKPS4 which includes phaC1 encoding PHA polymerase from P. oleovorans in the pTrc vector (Pharmacia). In this construct, phaC1 is preceded by a strong ribosome binding site: AGGAGGTTTTT(-ATG). The phaC1 gene including the upstream sequences, was cloned as a blunt ended EcoRI-HindIII fragment in the SmaI site of pUC18Sfi to give pMSXC3. A blunt ended cat gene cassette was subsequently cloned in the blunt-ended Sse8387II site, resulting in pMSXC3cat. At this point, all of the phaC1 coding region except the 5′ 27 base pairs were removed as a PstI-BamHI fragment and replaced by the corresponding fragment from the phbC gene from Z. ramigera. The resulting plasmid pMSXC5cat enc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
cell densityaaaaaaaaaa
volumeaaaaaaaaaa
volumeaaaaaaaaaa
Login to View More

Abstract

Transgenic microbial strains are provided which contain the genes required for PHA formation integrated on the chromosome. The strains are advantageous in PHA production processes, because (1) no plasmids need to be maintained, generally obviating the required use of antibiotics or other stabilizing pressures, and (2) no plasmid loss occurs, thereby stabilizing the number of gene copies per cell throughout the fermentation process, resulting in homogeneous PHA product formation throughout the production process. Genes are integrated using standard techniques, preferably transposon mutagenesis. In a preferred embodiment wherein mutiple genes are incorporated, these are incorporated as an operon. Sequences are used to stabilize mRNA, to induce expression as a function of culture conditions (such as phosphate concentration), temperature, and stress, and to aid in selection, through the incorporation of selection markers such as markers conferring antibiotic resistance.

Description

CROSS-REFERENCE TO RELATED APPLICATIONS [0001] Priority is claimed to U.S. provisional application Ser. No. 60 / 096,852, filed Aug. 18, 1998, the teachings of which are incorporated herein.BACKGROUND OF THE INVENTION [0002] The present invention is generally in the field of biosynthesis of poly(3-hydroxyalkanoates), and more particularly to improved microbial strains useful in commercial production of polyhydroxyalkanoates. [0003] Poly(3-hydroxyalkanoates) (PHAs) are biological polyesters synthesized by a broad range of bacteria. These polymers are biodegradable and biocompatible thermoplastic materials, produced from renewable resources, with a broad range of industrial and biomedical applications (Williams & Peoples, CHEMTECH 26:38-44 (1996)). PHA biopolymers have emerged from what was originally considered to be a single homopolymer, poly-3-hydroxybutyrate (PHB) into a broad class of polyesters with different monomer compositions and a wide range of physical properties. About 100 ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(United States)
IPC IPC(8): C12N1/21C12N9/00C12N9/02C12N15/09C12N9/04C12N9/10C12N9/88C12N15/90C12P7/62C12R1/19
CPCC12N9/00C12N9/0004C12N9/0006C12N9/1025C12N9/1029Y10S435/831C12N9/88C12N15/90C12P7/625Y10S435/877Y10S435/829C12N9/13C12N1/00
InventorHUISMAN, GJALT W.PEOPLES, OLIVER P.SKRALY, FRANK A.
OwnerMETABOLIX