Acid beta-mannase, genes, engineering bacteria and structure thereof

A mannanase and engineering bacteria technology, applied in the field of genetic engineering, can solve the problems of low yield of mannanase and the like, and achieve the effects of good heat resistance and wide enclosure

Inactive Publication Date: 2010-06-09
CENT SOUTH UNIV
View PDF8 Cites 27 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the low yield of mannanase produced by natural fungi, it cannot meet the needs of industrial production. Therefore, the current research and production of acid mannanase are mainly based on the construction of engineered bacteria. The currently reported fungal β-mannanase engineering Pichia pastoris from the Aspergillus sulforaphane gene, Saccharomyces cerevisiae from the Aspergillus aculeatus gene and Saccharomyces cerevisiae from the Trichoderma reesei gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Acid beta-mannase, genes, engineering bacteria and structure thereof
  • Acid beta-mannase, genes, engineering bacteria and structure thereof
  • Acid beta-mannase, genes, engineering bacteria and structure thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0056] Example 1. Obtaining the whole gene of β-mannanase from Aspergillus niger CBS 513.88

[0057] 1. Interception of gene fragments

[0058] Obtain the β-mannanase gene An15g07760 (see SEQ ID No.3) of Aspergillus nigerCBS 513.88 bacterial strain in NCBI database, analyze its sequence and optimize this gene sequence according to Pichia pastoris codon preference and mRNA structure, adopt SignalP 3.0 Server online analysis software analyzes the signal peptide of the protein encoded by the gene and excises the gene sequence encoding the signal peptide, adds an XhoI restriction site (C^TCGAG) and a CG protection base at the 5' end, and adds XbaI ( T^CTAGA) restriction site and protection base GC to obtain optimized β-mannanase gene (see SEQ ID No.4). Design three primers:

[0059] Fn-Man: GACCGCTCGAGAAGAGAGCTTCTAATC, see SEQ ID No.5;

[0060] Rn-Man1: GCTCTAGAGCAGCACCTTCCCAATTC, see SEQ ID No.6;

[0061] Rn-Man2: GCTCTAGAGCTTAAGCACCTTCCCAATTC, see SEQ ID No. 7.

[0062] The...

Embodiment 2

[0087] Embodiment 2, construction of Aspergillus niger β-mannanase expression engineering bacteria

[0088] 1. Construction of β-mannanase gene amplification vector and gene amplification

[0089] The complete β-mannanase gene (see SEQ ID No.4) obtained by Assembly PCR and LCR was ligated into pGEM-T vector, and then transferred into DH5α competent cells by the same method as above. After the white spots were picked and identified as positive clones by colony PCR, they were sent to Shanghai Sunny Biotechnology Co., Ltd. for sequencing. The β-mannanase gene recombinant plasmid clone without mutation identified by sequencing was preserved for future use.

[0090] 2. Construction of β-mannanase gene Pichia pastoris expression vector

[0091] 1) Methanol-inducible expression vector pPICZα-man

[0092] Cultivate the DH5α clone of the recombinant β-mannanase gene, and extract pGEM-man by alkaline lysis (using the specific method described in the book "Molecular Cloning Experiment...

Embodiment 3

[0111] Embodiment 3, inducible expression of Aspergillus niger β-mannanase

[0112] Pick a stable recombinant monoclonal strain, inoculate it into a 250mL shake flask containing 25mL BMGY, and cultivate it to OD at 28-30°C, 250-300rpm 600 = 2-6 (about 16-18 hours). Inoculate 25mL medium into a 3L shake flask containing 1L BMGY, shake vigorously at 28-30 degrees (250-300rpm), until the logarithmic growth phase (OD 600 =2-6). Use a sterilized centrifuge tube and centrifuge at 1500-3000g at room temperature for 5min to collect the cells. Remove supernatant and resuspend cells to OD with BMMY 600 =1.0(2-6). Divide the medium into three 3L septum shaker flasks, cover with 2 layers of sterile gauze or cheese cloth, and put them in a shaker at 28-30°C to continue culturing. Every 24 hours, add methanol to a concentration of 0.5% until the optimal induction time is reached. Take bacterial liquid samples according to the time points ((24h, 48h, 60h, 72h, 96h), the sampling volume...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses acid beta-mannase, genes, engineering bacteria and a structure thereof. A coding gene manAsp is from Aspergillus niger CBS 513.88, the coding gene has a nucleotide sequence expressed as SEQ ID NO.3 or 4, and the acid beta-mannase obtained by coding has an amino acid sequence expressed as SEQ ID NO.1 or 2. The structure of the engineering bacteria is obtained by guiding a pichia pastoris constitutive expression vector (pGAPZa-man) containing the coding gene sequence of the beta-mannase into pichia pastoris. The acid beta-mannase of the invention has the following properties: at the optimal pH of 5.0 and the optimal temperature of 40 DEG C, the beta-mannase has better stability when the pH is between 3.0 and 7.0, and the residual enzyme activity is 66.39 percent when the beta-mannase is treated for 1 hour at the temperature of 90 DEG C; the engineering bacteria achieve efficient expression of the acid beta-mannase; and the fermentation process is simple, has low extracting cost, is suitable for large-scale industrialized production, and has broad application prospect in the industries of feed, food, medicine, energy and the like.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and mainly relates to β-mannanase, gene, engineering bacteria and its construction, in particular to an acidic β-mannanase gene derived from Aspergillus niger and its high-efficiency expression of Pichia pastoris gene Construction and application of engineering bacteria. technical background [0002] β-mannanase (endo-1,4-β-D-mannanmanno hydroase EC 3.2.1.78) is a class of endohydrolase that can hydrolyze glycosidic bonds containing β-1,4-D-mannan, belonging to hemicellulase. It has a wide range of substrates, including plant polysaccharides such as mannan, glucomannan, galactomannan and galactoglucomannan (Tipdon, R.S. et al. Advances in carbohydrate chemistry and biochemistry, 32: 299-316 , Academic press, NewYork, 1976), using β-mannan to carry out deep processing and comprehensive utilization of a large number of plant materials containing the above-mentioned sugars, such as konjac powder...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12N1/19A23K1/165C12R1/84C12R1/685
Inventor周洪波赵伟郑甲王俐琼郭宁林福来
OwnerCENT SOUTH UNIV