Transformation of acidic beta-mannase gene and construction of engineering bacteria of acidic beta-mannase gene

A mannanase and acid technology, applied in the field of genetic engineering, can solve the problems of low yield, complicated fermentation process and high cost, and achieve the effect of good heat resistance

Inactive Publication Date: 2012-09-19
JINANBESTZYME BIO ENG CO LTD
View PDF7 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the production of mannanase mainly adopts the liquid fermentation method of bacteria or bacillus. The main disadvantage is that it needs substrate induction, and the fermentation process is complex, high cost, low yield, low enzyme activity and the produced neutral enzyme is not suitable for acid Action environment

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transformation of acidic beta-mannase gene and construction of engineering bacteria of acidic beta-mannase gene
  • Transformation of acidic beta-mannase gene and construction of engineering bacteria of acidic beta-mannase gene
  • Transformation of acidic beta-mannase gene and construction of engineering bacteria of acidic beta-mannase gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0045] Example 1 Obtaining the whole gene of β-mannanase from Aspergillus niger CBS 513.88

[0046] Extraction of gene fragments

[0047]The β-mannanase gene An15g07760 of Aspergillus niger CBS 513.88 strain was obtained from the NCBI database, its sequence was analyzed and the gene sequence was optimized according to the codon preference and mRNA structure of Pichia pastoris, and the SignalP 3.0 Server online analysis software was used to analyze the gene sequence. The signal peptide of the protein encoded by the gene and the gene sequence encoding the signal peptide are excised, and the XhoI restriction site (C^TCGAG) and CG protection base are added to the 5' end, and the XbaI (T^CTAGA) enzyme digestion is added to the 3' end Site and protection base GC to obtain optimized β-mannanase gene. Design three primers:

[0048] Fn-Man: GACCGCTCGAGAAGAGAGCTTCTAATC;

[0049] Rn-Man1: GCTCTAGAGCAGCACCTTCCCAATTC;

[0050] Rn-Man2: GCTCTAGAGCTTAAGCACCTTCCCAATTC.

[0051] Synthes...

Embodiment 2

[0074] Example 2 Construction of engineering bacteria expressing Aspergillus niger β-mannanase

[0075] Construction of β-mannanase Gene Amplification Vector and Gene Amplification

[0076] The complete β-mannanase gene obtained by Assembly PCR and LCR was connected to the pGEM-T vector, and then transferred into DH5α competent cells, the method was the same as above. After the white spots were picked and identified as positive clones by colony PCR, they were sent to Shanghai Sunny Biotechnology Co., Ltd. for sequencing. The β-mannanase gene recombinant plasmid clone without mutation identified by sequencing was preserved for future use.

[0077] Construction of expression vector of β-mannanase gene Pichia pastoris

[0078] Methanol-inducible expression vector pPICZα-man

[0079] The DH5α clone of the recombinant β-mannanase gene was cultivated, and pGEM-man was extracted by alkaline lysis (using the specific method described in the book "Molecular Cloning Experiment Guid...

Embodiment 3

[0098] Example 3 Inducible expression of Aspergillus niger β-mannanase

[0099] Pick a stable recombinant monoclonal strain, inoculate it into a 250mL shake flask containing 25mL BMGY, and cultivate it at 28-30°C and 250-300rpm until OD600=2-6 (about 16-18 hours). Inoculate 25mL medium into a 3L shake flask containing 1L BMGY, shake vigorously at 28-30°C (250-300rpm), and reach the logarithmic growth phase (OD600=2-6). Use a sterilized centrifuge tube and centrifuge at 1500-3000g at room temperature for 5min to collect the cells. Remove the supernatant and resuspend the cells with BMMY to OD600=1.0 (2-6). Divide the medium into three 3L septum shaker flasks, cover with 2 layers of sterile gauze or cheese cloth, and put them in a shaker at 28-30°C to continue culturing. Every 24 hours, add methanol to a concentration of 0.5% until the optimal induction time is reached. Bacteria liquid samples were taken according to time points ((24 h, 48 h, 60 h, 72 h, 96 h), the sampling...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses transformation, synthesis and splicing of acidic heat-resistant beta-mannase gene and construction of engineering bacteria containing the acidic heat-resistant beta-mannase gene. An encoding gene has a nucleotide sequence shown as SEQIDNO.3 or SEQIDNO.4; and the acidic beta-mannase obtained by encoding has an amino acid sequence shown as SEQIDNO.1 or SEQIDNO.2. According to the construction of the engineering bacteria, the engineering bacteria are obtained by introducing Pichia pastoris constitutive expression vector (pGAPZalpha-man) into Pichia pastoris. The acidic heat-resistant beta-mannase gene disclosed by the invention has the following properties that the optimum action pH is 5.0, the optimum action temperature is 40DEG C, the structure is favorable and the properties are stable when the pH value is in a range of 3.0 to 7.0 and the remained enzyme activity is over 70 percent after an enzyme liquid is treated at high temperature of 90 DEG C for 5 minutes; meanwhile, the acidic heat-resistant beta-mannase gene has high specific activity and better proteinase resistance; and the engineering bacteria realize high-level expression of the acidic heat-resistant beta-mannase gene and has the advantages of simple fermentation process, low extraction cost, suitability for large-scale industrial production and wide application prospect.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and specifically relates to the transformation, synthesis, splicing and construction of engineering bacteria containing the gene of β-mannanase, in particular to a whole gene of fungal acidic β-mannanase and its high-efficiency expression engineering bacteria build. Background technique [0002] β-Mannanase has been isolated from organisms of different origin, including plants (such as the seeds and fruits of tomato), lower animals (such as the blue mussel Mytilus deulis) and microorganisms (Millward-Sadler, et al. Microbiol. Lett . 141, 183-188). Wherein microorganisms are an important source of producing β-mannanase, and reported ones include Bacillus, Aeromonas, Xanthomonas, Clostridium, Penicillium, Trichoderma and Streptomyces etc. (Braithwaite, et al. , Biochem. J, 305:1005-1010, 1995; Duffaud, et al., Appl Environ Microbiol, 63(1): 169-177,1997; Reese and Shibata, Can J Microbiol, 11 :...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/81C12N1/19A23K1/165C12R1/685C12R1/66C12R1/84
Inventor郭芳坤
OwnerJINANBESTZYME BIO ENG CO LTD