Beta-mannanase and preparation method thereof

A technology of mannanase and glycerol, which is applied in the fields of botany equipment and methods, biochemical equipment and methods, and microbial-based methods, can solve the problems of unseen and unseen production of mannanase, and achieve high-efficiency expression , good thermal stability and high enzyme activity

Active Publication Date: 2012-10-17
CHINA AGRI UNIV
View PDF10 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are many studies on cellulase and xylanase of Chaetomium in China, but there is no research on its production of mannanase, and there are no related reports abroad (BRENDA http: / / www.brenda-enzymes.org / )

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Beta-mannanase and preparation method thereof
  • Beta-mannanase and preparation method thereof
  • Beta-mannanase and preparation method thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0048] Example 1: Cloning of the β-mannanase gene of Chaetomium CQ31

[0049] The obtaining of the full-length gene sequence of the β-mannanase of Chaetomium CQ31 comprises the following steps:

[0050] 1. Cloning of β-mannanase gene fragment

[0051] According to the amino acid sequence of the fungal β-mannanase announced in GenBank, the conserved sequence was analyzed by comparison, and Codehop software ( http: / / bioinformatics.weizmann.ac.i1 / blocks / codehop.html ) online design of degenerate primers, the sequences of degenerate primers and corresponding conserved amino acids are as follows:

[0052] DP1 (upstream primer): CCTGCGCGTCTGGGGNTTYAA(LRVWGF)

[0053] DP2 (downstream primer): CGTTGGCCAGCTCCCCANGCRAA(FAWELANE)

[0054] Where Y: A / G, N: A / T / G / C, R: C / T

[0055] In the PCR reaction, the total DNA of Chaetomyces CQ31 was used as a template, DP1 and DP2 were used as primers, and Ex taq DNA polymerase (Takara Company) was used to amplify. The program was: 94°C pre-de...

Embodiment 2

[0064] Example 2: Construction and high-efficiency expression of Chaetomium CQ31 β-mannanase expression engineering bacteria

[0065] 1. Construction of engineering bacteria expressing β-mannanase

[0066] Design expression primers according to the sequence of the yeast expression vector and β-mannanase, and the upstream and downstream primers are respectively added with EcoR I and Not I restriction sites. The upstream and downstream primers are as follows:

[0067] Upstream primers: GAATTC CCAAGCCGAGCTGTGCAGG (EcoR I)

[0068] Downstream primers: GCGGCCGC TTAGTCACTTCTCGCCTCGCTA (Not I).

[0069] Use the above primers to amplify the eDNA obtained from the reverse transcription of the total RNA of Chaetomyces CQ31 in Example 1. After the PCR product is detected by agarose gel electrophoresis, it is recovered and connected to the pMD-18T vector, and transformed into E.coli From JM109 (purchased from Bomed Biological Company), a single colony was selected for sequencing. Th...

Embodiment 3

[0078] Embodiment 3: Purification and enzymatic properties of Chaetomium β-mannanase

[0079] 1. Definition and determination method of enzyme activity

[0080] Enzyme activity was determined by DNS method. 100 μL of appropriately diluted enzyme solution was added to 900 μL of 0.5% locust bean gum (LBG) prepared in 50 mM pH 5.0 citrate buffer, and reacted at 55° C. for 10 min. After the reaction, the reaction was terminated with DNS reagent and reacted with reducing sugar. With mannose as the marking line, define the amount of enzyme needed to generate 1 μmol mannose per minute as 1U.

[0081] 2. Purification of β-mannanase

[0082] 10mL of the fermentation broth supernatant of the fermenter, after dialysis equilibration, was loaded on a Q-Sepharose column equilibrated with 20mM pH 6.5 phosphate buffer. After washing unbound protein with 5 column volumes of buffer, 0-500 mM NaCl was linearly eluted and fractionated. After the obtained pure enzymes were combined, they were...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses beta-mannanase and a preparation method thereof. The beta-mannanase provided in the invention is a protein which is a protein 1, a protein 2 or a protein 3, wherein the protein 1 is composed of a 22-416 amino acid sequence shown in a sequence 1 in a sequence table; the protein 2 is composed of an amino acid sequence represented by the sequence 1 in the sequence table; and the protein 3 is obtained through substituting and / or deleting and / or adding one or more amino acid residues to an amino acid residue sequence of the protein 1 or the protein 2, has activities of the beta-mannanase, and is derived from the protein 1 or the protein 2. Engineering bacteria formed by introducing protein coding gen into Pichia pastoris are fermented in a 5L fermenting tank in a high density manner, and the enzymatic activity of a fermenting solution can reach 50029.6U / mL (the protein content is 6.1mg / mL), so efficient express is realized. The beta-mannanase of the invention has application potentials in the food industry, the medicine industry, the papermaking industry, the forage industry, the petroleum exploitation industry, the fine chemical engineering industry and the like.

Description

technical field [0001] The present invention relates to β-mannanase and its preparation method. Background technique [0002] β-mannanase (endo-1, 4-β-D-mannanmanno hydroase EC 3.2.1.78) is the hydrolysis of mannan (glucomannan) with β-1, 4-D-mannopyranose as the main chain Endohydrolase of sugar, galactomannan, etc.). Mannan is a linear polymer connected by β-1,4-D-mannopyranose. It is the second largest component of hemicellulose and widely exists in nature. It is a variety of plant cell walls. main constituents. β-mannanase is widely used in feed, food, papermaking, biotransformation and other industries, and is an important industrial enzyme (Cui Xu, Cao Yunhe, Li Ruiguo. Research progress of β-mannanase. Chinese Journal of Animal Husbandry, 2010, 46(15):69-72). β-mannanase exists widely in nature. Plants, some lower animals and most microorganisms can produce mannanase. Microorganisms are the main source of mannanase because of their relatively simple growth condi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N5/10C12N1/19C12P19/14C12R1/645C12R1/91C12R1/84
Inventor江正强周鹏闫巧娟波丽特徐海博
OwnerCHINA AGRI UNIV