Unlock instant, AI-driven research and patent intelligence for your innovation.

Novel high-temperature beta-glucosidase, its coding gene and application

A coding and application technology, applied in application, genetic engineering, plant genetic improvement, etc., can solve the problems of low β-glucosidase activity, unsatisfactory yield, physical and chemical properties, and catalytic efficiency, and achieve the effect of strong tolerance

Active Publication Date: 2013-01-30
CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI
View PDF1 Cites 16 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] In addition, β-glucosidases of different properties are required for different industrial applications, and most of the existing technologies, especially the β-glucosidases derived from bacteria, have low activity, and are ineffective in terms of yield, physical and chemical properties, and catalytic efficiency. It is far from meeting the needs of modern industrial production

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel high-temperature beta-glucosidase, its coding gene and application
  • Novel high-temperature beta-glucosidase, its coding gene and application
  • Novel high-temperature beta-glucosidase, its coding gene and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0093] Embodiment 1, the isolation of β-glucosidase and its coding gene

[0094] Using metagenomic technology, the β-glucosidase-positive clone Y8001 was screened from the termite intestinal metagenome system by conventional methods, and the plasmid DNA of this clone was extracted for 454 high-throughput sequencing. After the sequences were spliced, a relatively complete fosmid fragment could be obtained sequence. Search ORF with DNAStar software, search GenBank database with Blastn of NCBI (http: / / www.ncbi.nlm.nih.gov), obtain the coding gene of β-glucosidase, this gene has SEQ ID No.1 in the sequence listing The nucleotide sequence was named bgl1. From the 5' end of SEQ ID No.1 in the sequence listing, the 1st to 1368 nucleotides are the open reading frame (Open Reading Frame, ORF) of bgl1, from the 1st-3rd core of the 5' end of SEQ ID No.1 The nucleotide is the start codon ATG of the bgl1 gene, and the 1366th to 1368th nucleotides from the 5' end of SEQ ID No. 1 are the s...

Embodiment 2

[0096] Example 2, expression of bgl1 in Escherichia coli

[0097] 1. Construction of recombinant expression vector

[0098] The predicted β-glucosidase ORF coding gene was amplified by PCR from the fosmid-positive clones screened above, and the forward primer used was: 5'CGCGGATCCATGGAAAAATATGTGTTT 3'(SEQ ID NO: 3), and BamH was added to its 5' end I recognition site: GGATCC; the reverse primer is 5' CCGCTCGAGTTACCAA TCGGCAAAACC 3' (SEQ ID NO: 4), and the Xho I recognition site: CTCGAG is added to its 5' end.

[0099] After the PCR product was purified, it was digested with BamH I and Xho I, and the DNA fragment was recovered by using the Axygen PCR product column recovery kit, and the DNA fragment was mixed with the recovered vector pET-28a(+) ( Novagen) was ligated overnight at 16°C with T4 DNA ligase to obtain the recombinant expression vector pET28a(+)-bgl1. There is a His tag (6×His-Tag) provided by the expression vector at the N-terminus of the expression product to fa...

Embodiment 3

[0108] Example 3. Analysis of recombinant Bgl1 proteolytic properties

[0109] Use p-nitrophenyl-β-D-glucoside (pNPG) as the substrate to detect the enzyme activity and physical and chemical properties of β-glucosidase, the specific operation is as follows:

[0110] (1) p-nitrophenol (pNP) standard curve preparation

[0111] Take a PCR plate arranged in 8*3, add the solution according to Table 4, a total of 8 groups, and each group has 3 parallel repetitions.

[0112] Table 4

[0113]

[0114] The pNP concentration was 10 mg / ml. Add 100 μl 1M NaCO3 to each standard sample in the above table to stop the reaction and develop color, pipette 100 μl into the microplate plate, measure the light absorption at 405 nm with a microplate reader, and the standard sample number 0 is the blank control. The marking line was prepared after subtracting the blank from each sample value.

[0115] (2) Determination of standard enzyme activity

[0116] In a 100μl reaction system, add 50μl ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Theoretical molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to novel beta-glucosidase, and its coding gene and application. The invention further relates to an expression vector and host cells which contain the coding gene. The invention also relates to a method for using the beta-glucosidase to hydrolyze cellobiose generated in the process of cellulose degradation to glucose. The beta-glucosidase disclosed herein has the characteristics of high temperature resistance and good stability under neutral and alkaline conditions, and can be well applied in industrial production.

Description

technical field [0001] The invention belongs to the field of biotechnology, and relates to a novel high-temperature resistant beta-glucosidase, its coding gene and application. Background technique [0002] Introduction to Cellulose. Cellulose is a polymer composed of multiple glucose residues linked by β-1,4-glycosidic chains, and is the most abundant renewable biomass resource on earth. Using lignocellulose as raw material, hydrolyzing cellulose with cellulase to generate glucose, and then fermenting it into fuel ethanol has become an important way to deal with the problems of energy crisis and environmental pollution in the world today. [0003] Introduction to cellulase. Cellulase refers to the general term for a series of enzymes that can convert cellulose into glucose, mainly including endo-β-1,4-glucanase (EC 3.2.1.4), exoglucanase (exoglucanase, EC 3.2.1.91) and β-glucosidase (β-glucosidase, EC 3.2.1.21). Endoglucanase acts on the inside of the long-chain cellulo...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12N15/56C12N15/63C12N1/21C12N1/19C12N5/10C12P19/14C12P19/02C12P33/20C12P1/00C12P7/22
Inventor 周志华王钱福钱昌丽刘宁严兴魏维王倩谢磊黄勇平
Owner CAS CENT FOR EXCELLENCE IN MOLECULAR PLANT SCI