Xylitol genetic engineering bacteria and method for producing xylitol via mixed transformation by same

A technology of genetically engineered bacteria and xylitol, which is applied in the construction of xylitol genetically engineered bacteria, and in the field of mixed transformation of D-arabitol to produce xylitol, which can solve the problems of low conversion rate, complicated process, and complicated fermentation process.

Active Publication Date: 2013-02-20
丁勇
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003]At present, the industrial production of xylitol mainly adopts the chemical acidification catalytic hydrogenation method and the use of microorganisms to directly ferment the hemicellulose hydrolyzate to produce xylitol. Most of the raw materials come from agricultural and sideline products such as corn cobs and bagasse rich in pentosan. These raw materials are firstly hydrolyzed at high temperature and then become a hydrolyzate containing a large amount of xylose. Therefore, there are high acid and alkali consumption, serious environmental pollution, and complicated processes. question
The research on the preparation of xylitol by the whole biological method has attracted global attention, but no microorganisms that directly ferment glucose to produce xylitol have been found in nature
In 1969, Onishi and Suzuki first reported the conversion of glucose into xylitol by three-step fermentation, first using Osmophilic yeast to convert glucose into D-arabitol, and then using Acetic acid bacteria Oxidize the generated D-arabitol to D-xylulose, and then reduce D-xylulose to xylitol by a yeast, but the conversion rate is very low, and the subsequent fermentation process is complicated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Xylitol genetic engineering bacteria and method for producing xylitol via mixed transformation by same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Embodiment 1, the acquisition of genetically engineered bacteria with xylitol dehydrogenation high enzyme activity

[0030] According to the xylitol dehydrogenase gene sequence of Gluconobacter oxidans published in NCBI and the characteristics of the multiple cloning sites on the expression vector pSE380, a degenerate primer was designed and synthesized using bioinformatics software: P1: 5'TA CCATGG TTCACCACCATCATCACCATCATATGTCGAAGAAGTTTAAG3' (with Nco Ⅰ restriction site); P2: 5'TG AAGCTT TCAACCGCCAGC AAT3' (with Hind III restriction site).

[0031] The target gene was amplified by PCR using the genomic DNA of Gluconobacter oxydans as a template.

[0032] PCR reaction parameters: pre-denaturation: 95 ℃ 2min; denaturation: 94 ℃ 30sec; renaturation: 55 ℃ 30sec; extension: 72 ℃ 1min; cycle: 35; termination extension: 72 ℃ 10min; final 16℃ incubation

[0033] The PCR product was detected by 1% agarose electrophoresis, and the PCR product with a fragment size of ab...

Embodiment 2

[0046] Embodiment 2, preparation xylitol

[0047] (1) Gluconobacter oxidans was first cultured in the seed liquid medium, and 2-3 epoxidized Gluconobacter slant colonies were picked in 10 ml of the seed liquid medium, and cultured with shaking at 28°C and 100 rpm for 8 hours. Seed liquid medium includes: glucose 20.0 g / L, tryptone 1.0 g / L, yeast extract 2.0 g / L; Gluconobacter oxidans slant medium: glucose 20 g / L, tryptone 1 g / L, yeast extract 2 g / L, agar 10 g / L.

[0048] (2) The seed solution was inoculated into the expansion medium at an inoculation amount of 1%, and shaken at 28 °C and 100 rpm for 48 hours. The expansion medium included: glucose 20.0 g / L, yeast extract 2.0 g / L, tryptone 1.0 g / L, D-arabinitol 5.0 g / L, calcium carbonate 10.0 g / L.

[0049] (3) Centrifuge the fermentation broth in (2) at 6000 rpm at 4°C for 5 min, collect the bacteria sludge, wash twice with 0.1 mol / L potassium phosphate buffer of pH 6.8, resuspend with an appropriate amount of cell transfor...

Embodiment 3

[0051] Embodiment 3, preparation xylitol

[0052] (1) Gluconobacter oxydans was first cultured in the seed liquid medium, and 2-3 epoxidized Gluconobacter slant colonies were picked in 10 ml seed liquid medium, and cultured at 37 °C and 260 rpm for 20 h with shaking. The seed liquid medium includes: glucose 40.0 g / L, tryptone 10.0 g / L, yeast extract 20.0 g / L.

[0053] (2) The seed solution was inoculated into the expansion medium at an inoculation amount of 10%, and cultured with shaking at 37 °C and 260 rpm for 96 hours. The expansion medium includes: glucose 40.0 g / L, yeast extract 20.0 g / L, tryptone 10.0 g / L, D-arabitol 20.0 g / L, calcium carbonate 20.0 g / L; Gluconobacter oxidans slant medium: Glucose 40.0 g / L, tryptone 10.0 g / L, yeast extract 20.0 g / L, agar 20 g / L.

[0054] (3) Centrifuge the fermentation broth in (2) at 12,000 rpm at 4°C for 20 min, collect the bacteria sludge, wash twice with 0.1 mol / L potassium phosphate buffer of pH 6.8, resuspend with an appropriat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Pre-denaturedaaaaaaaaaa
Extendaaaaaaaaaa
Login to View More

Abstract

The invention relates to xylitol genetic engineering bacteria and a method for producing xylitol via mixed transformation by the same, and relates to the field of biology thechnology. The invention provides the construction of xylitol genetic engineering bacteria E.coliBL21-xdh06. The genetic engineering bacteria are obtained by acquiring xdh genes of xylitoldehydrogenase (XDH) from gluconobacteroxydans via a PCR method and cloning the xdh genes performing stable and efficient expression in host bacteria E.coliBL21. The xylitoldehydrogenase expressed by the genetic engineering bacteria is increased by 10 times in enzyme activity; and genetic engineering bacteria of D-arabitol is increased from 29% to 91.6% via mixed static transformation of the D-arabitol by using the genetic engineering bacteria and gluconobacteroxydans to produce the xylitol.

Description

Technical field [0001] The invention involves the field of biotechnology, involving the construction of a type of pyrium alcohol gene engineering bacteria and it is used to mixed the method of transforming D-Arabitol to produce lignol. Background technique [0002] Lylisol is a kind of five carbon sugar, its chemical name is 1,2,3,4,5 — pentol alcohol, and the molecular formula is C 5 H 12 O 5 It is a kind of white crystal or crystalline powder. Its solubility, solution density, and folding coefficients are basically the same as sucrose and can be used as alternatives of sucrose.Lienol is a natural sweet substance with high nutritional value, and it is also a low -energy sweetener.Lylisol is the intermediate of the metabolism of human sugar. It does not consume insulin after consumption, and xylitol has a special anti -caries function.It has various functions such as reducing blood sugar concentration and promoting calcium absorption. [0003] At present, the production of xylito...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P39/00C12P19/02C12R1/19C12R1/01
Inventor齐向辉郭齐王飞邓文颖王亮孙文敬陈华友蒙健宗张云光
Owner丁勇