Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Urease high-yielding Aspergillus sydowii and application thereof

A technique for producing Aspergillus polypolymosa and urease, which is applied in the field of microorganisms, can solve the problems such as Aspergillus polypolypolysaccharide that have not been reported, achieve great application and promotion value, improve safety and quality, and reduce the content of urea

Active Publication Date: 2013-03-27
四川绵竹剑南春酒厂有限公司
View PDF1 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, no report has been reported that Aspergillus polypolyphaga has the ability to produce high urease

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Urease high-yielding Aspergillus sydowii and application thereof
  • Urease high-yielding Aspergillus sydowii and application thereof
  • Urease high-yielding Aspergillus sydowii and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Example 1 strain screening

[0032] 1. Primary screening of strains

[0033] Material: distiller's yeast used by Sichuan Jiannanchun (Group) Co., Ltd.

[0034] Medium: peptone 10.0g, glucose 18g, 0.4% phenolphthalein solution 3mL, sodium chloride 5.0g, potassium dihydrogen phosphate 2.0g, agar 20.0, distilled water 1000mL. Dissolve the above ingredients except phenolphthalein, adjust the pH to 6.8~6.9, and then add phenolphthalein indicator. Divide into triangular flasks and sterilize at 121°C for 15 minutes. When the culture medium is cooled to 50-55°C, add 20% urea aqueous solution that is pre-filtered and sterilized so that the final concentration in the medium is 2%, shake well and set aside .

[0035] Experimental method: Take 10 grams of distiller's yeast under aseptic conditions in a 25 mL Erlenmeyer flask filled with 90 mL of sterile water and glass beads, place it on a bed and shake it at room temperature for 30 minutes. The bacterial solution was diluted t...

Embodiment 2

[0041] The identification of embodiment 2JNC-U5 bacterial strain

[0042] 1. 18S rDNA sequence analysis

[0043] (1) DNA extraction

[0044] Collect the bacteria, dissolve in 5mL extraction buffer (100mM Tris Cl, 100mM EDTA-Na 2 , 200mM NaCl, 2%CTAB, pH8.0), shake at 37°C for 45min. Add 0.75mL 20% SDS, and bathe in water at 65°C for 1h. Centrifuge at 12,000rpm for 10min, and collect the supernatant. The supernatant was extracted twice with an equal volume of phenol: chloroform: isoamyl alcohol (25:24:1), added with a final concentration of 0.3M NaAC (pH 5.2) and 2 times the volume of absolute ethanol, and precipitated at room temperature for 1 h. 4°C, 12,000rpm, centrifuge for 20min, collect the precipitate, rinse twice with 70% ethanol, dry and dissolve in 50μL TE (10mmTris-HCl, 1mmNa 2 EDTA) to obtain total DNA.

[0045] (2) Amplification of 18S rDNA

[0046]Using the total DNA as a template, fungal universal primers 18SF (SEQ ID No. 2: CCAACCTGGTTGATCCTGCCAGTA) and 1...

Embodiment 3

[0060] Embodiment 3 Morphological characteristics and carbon source utilization characteristic identification of Aspergillus strain of the present invention

[0061] 1. Colony morphology and bacterial microscopic observation

[0062] Activate the strains stored at 4°C with ME slant medium for 3 days, then use the inoculation needle to pick up the colonies on the slant and inoculate them on the ME plate medium, culture at 28°C for 7 days, observe the colony morphology, and observe the conidia under a microscope and the morphology of the spore spores (see figure 2 ). Quanta TM 450FEG to observe the ultrastructure of bacteria (see image 3 and Figure 4 ).

[0063] The Aspergillus colony grows radially on the ME medium, with radial grooves, and the diameter is about 22-30 mm after being cultured at 28°C for 7 days; the color is grayish green, with white halos around; the opposite side of the colony is light brown or dark brown. Conidiophores are born directly on the matrix...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a urease high-yielding Aspergillus sydowii strain and application thereof, and belongs to the field of microbiology. The invention solves a technical problem by providing an urease high-yielding Aspergillus sydowii strain Aspergillus sydowii JNC-U5. The Aspergillus sydowii strain provided by the invention is preserved in China General Microbiological Culture Collection Center (CGMCC) on September 18, 2012, and has a preservation number CGMCC No.6577. The Aspergillus sydowii provided by the invention can produce urease reaching 49.7U, and can be used for production of high-purity urease.

Description

technical field [0001] The invention relates to aspergillus polypolypolydoi with high urease production and its use, belonging to the field of microbes. Background technique [0002] Urease (Urease, urea amidohydrolase, EC 3.5.), also known as urea aminohydrolase, exists in most bacteria, Aspergillus and higher plants. It is an amidase that hydrolyzes enzymatic bonds in molecules of organic substances. Its action is extremely specific, it can only hydrolyze urea, and the final products of hydrolysis are ammonia and carbonic acid [1] . [0003] In foreign countries, Lactobacillus has been used to produce urease enzyme preparations, which can effectively reduce the urea content in wine [2-6] . In China, urease has been used to reduce the urea content in rice wine. However, the production capacity of urease for wine has not yet formed in our country, and the enzyme preparations used at present are all imported from abroad. [7] . In the liquor industry, the research in th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/14C12N9/78C12G3/00C12R1/66
Inventor 唐清兰徐姿静魏勇徐占成
Owner 四川绵竹剑南春酒厂有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com