Check patentability & draft patents in minutes with Patsnap Eureka AI!

Polymerase chain reaction (PCR) detection kit for chromosome-integrated herpesvirus hominis 6

A detection kit and herpes virus technology, which is applied in the field of PCR detection kits for human herpes virus type 6, can solve the problems of high detection cost, high false positive, and false positive detection results, and achieve high sensitivity, strong specificity, Simple operation effect

Active Publication Date: 2014-04-30
NANJING MEDICAL UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the population, the latently infected non-chromosomally integrated form of HHV-6 virus is very low in whole blood, and HHV-6 DNA is usually detected in human peripheral blood by HHV-6 PCR, but HHV-6 detection is extremely sensitive and extremely Susceptible to trace aerosol pollution in the air, resulting in false positive test results; CI-HHV-6 can be detected by chromosome fluorescence in situ hybridization (fluorescence in 1 situ hybridization, FISH), but FISH technology first needs to culture human peripheral blood cells, Human metaphase chromosomes are prepared, HHV-6-specific fluorescent probes are synthesized, and eluted after hybridization. The detection cycle is long and the false positives are high. In addition, CI-HHV-6 can also be detected by fluorescent quantitative PCR (hereinafter referred to as Q-PCR). , but Q-PCR detection requires specific primers, probes and Q-PCR enzymes, and requires a special fluorescent quantitative PCR instrument. The detection cost is relatively high, which is not conducive to the repeated use of large-scale population censuses

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polymerase chain reaction (PCR) detection kit for chromosome-integrated herpesvirus hominis 6
  • Polymerase chain reaction (PCR) detection kit for chromosome-integrated herpesvirus hominis 6
  • Polymerase chain reaction (PCR) detection kit for chromosome-integrated herpesvirus hominis 6

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Detection of CI-HHV-6 in human peripheral blood

[0023] (1) Sample DNA extraction: red blood cell lysate, Proteinase K solution (Nanjing Kaiji Biotechnology Development Co., Ltd.), DNA extraction solution, NaAc, absolute ethanol, 75% ethanol by volume, and TE buffer; The erythrocyte lysate formula is 139.6 mmol / L NH4Cl solution with 16.96 mmol / L Tris-HCl added; the DNA extraction solution is a mixture of phenol, chloroform and isoamyl alcohol with a volume ratio of 25:24:1; TE buffer The formula is to add 1mmol / L EDTA to 10mmol / L Tris-HCl solution. ;

[0024] (2) PCR reagent tube components: 2×Taq Master Mix 15μl, ddH 2 O 11 μl, 1.0 μl concentration of 10 μM primer SEQ ID No.1, 1.0 μl concentration of 10 μM primer SEQ ID No.2;

[0025] SEQ ID No.1: 5'-GTTGACGGTGGAAGCCTTTTTA-3';

[0026] SEQ ID No. 2: 5'-TTTAGCGGGGACCATGTAGTTG-3'.

[0027] (3) Negative control: sterilized double distilled water;

[0028] (4) Positive control: HHV-6 standard strain GS DNA...

Embodiment 2

[0034]Example 2 Q-PCR method is used to detect chromosomal integration of human herpesvirus type 6 in samples No. 467-480.

[0035] The primer sequence that embodiment relates to:

[0036] SEQ ID No.3: 5'-CGCTCGGAAAGGAAACATTA- 3'

[0037] SEQ ID No.4: 5 '–AAGTGGAACTGCTTGGTGGC– 3'

[0038] The primer sequence construction refers to "The influence of human herpesvirus 6A on the tropism and cell cycle of nerve cells" Guo Dandan et al., Journal of Nanjing Medical University, July 2011.

[0039] (1) Construction of recombinant standard plasmid pMD19T-U22

[0040] Using GS DNA of the HHV-6 standard strain as a template (donated by Professor Wu Wenhan of the University of Hong Kong) and SEQ ID No.3 and SEQ ID No.4 as primers, PCR amplification reaction was carried out to obtain PCR amplification products.

[0041] PCR reaction system: 2×Taq Master Mix (produced by Beijing Biotech Biotechnology Co., Ltd. ) 15 μl, 1.0 μl of SEQ ID No.3 at a concentration of 10 μM...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
diameteraaaaaaaaaa
Login to View More

Abstract

The invention provides a polymerase chain reaction (PCR) detection kit for chromosome-integrated herpesvirus hominis 6. The detection kit comprises a deoxyribonucleic acid (DNA) extracting agent, a PCR reagent tube ingredient, negative control and positive control. By adopting the PCR detection kit, the blank of domestic CI-HHV-6 detection is compensated, whether the sample DNA contains a specific amplification band or not at 178bp is detected by the kit, whether the sample cell is injected with herpesvirus hominis 6 or not can be judged, and the PCR detection kit is simple in operation, high in sensitivity and strong in specificity.

Description

technical field [0001] The invention relates to a gene detection technology, in particular to a PCR detection kit for chromosomally integrated human herpesvirus type 6. Background technique [0002] Human Herpesvirus 6 (Human Herpesvirus 6, hereinafter referred to as HHV-6), is a type of human lymphocyte-tropic double-stranded DNA virus, which was first isolated from the peripheral blood of patients with lymphoid hyperplasia and AIDS in 1986 by Salahuddin et al. It is isolated from mononuclear cells and belongs to the betaherpesvirus subfamily. HHV-6 can infect a variety of cells in vivo, but the most sensitive ones are CD4+ T cells in peripheral blood mononuclear cells (PBMCs). HHV-6 infection is widespread in the population, and the positive detection rate of serum HHV-6 IgG antibody is very high. Most of the primary infections are in infancy, which is the pathogen that causes exanthem subitum (ES) in infants and young children, and then latent and persists in the host ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/70C12Q1/68
CPCC12Q1/686C12Q1/70C12Q2531/113
Inventor 周锋李凌云冯东举王芳姚堃陈云刘英霞
Owner NANJING MEDICAL UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More