Alpha-glucosidase and application of alpha-glucosidase

A technology of glucosidase and isomaltose, applied in the fields of application, glycosylase, enzyme, etc., can solve the problems of low enzyme expression and high cost, and achieve the effect of broad market prospects

Active Publication Date: 2015-02-04
QINGDAO VLAND BIOTECH GRP
View PDF4 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In China, the research on α-glucosidase is still mainly in the production strain selection and enzymatic properties of α-glucosidase, although there is A.niger α-glucosidase cDNA obtained by RT-PCR amplification, Construct a recombinant plasmid and try to express it in Escherichia coli, but the enzyme expression level is low, and the recombinant protein is an intracellular enzyme, the cost of separation and purification is relatively high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Alpha-glucosidase and application of alpha-glucosidase
  • Alpha-glucosidase and application of alpha-glucosidase
  • Alpha-glucosidase and application of alpha-glucosidase

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0019] Example 1: Cloning of α-glucosidase gene

[0020] Genomic DNA was extracted from S. niger overnight cultures using a fungal genomic DNA extraction kit (Omega).

[0021] Amplify the α-glucosidase gene in Staphylococcus niger with the genomic DNA of Staphylococcus niger as the amplification template, and the forward primer aGluS6480-F sequence used is (the sequence shown in the underline is the SnaBI restriction site) ;5′-CCAT TACGTA AGA ATGAGACTTGGGCTCGCCATCCTG-3′,

[0022] The sequence of the reverse primer aGluS6480-R is (the underlined sequence is the XbaI restriction site):

[0023] 5′-TGC TCTAGA TTAGAGCTCGTCCGAGCCCAACGCTTCCT - 3′

[0024] The gene was amplified from S. niger genomic DNA using Phusion DNA polymerase (Thermo scientific).

[0025] The above PCR products were purified using a gel purification kit (Fermentas). The purified PCR product was digested with restriction enzymes SnaBI and XbaI (Fermentas); at the same time, the plasmid pGm was digeste...

Embodiment 2

[0028] Example 2: PEG-mediated protoplast fusion transformation and verification of Aspergillus niger

[0029] Pipette the spore suspension of the host bacteria Aspergillus niger G1 (Aspergillus niger G1) in the center of the CMA plate (9cm petri dish), when the colony covers the entire petri dish, cut 1 / 4 of the size of the culture based on 200mL CMA liquid medium, in 30 Cultivate at 200rpm for 14-16h.

[0030] Collect the mycelium with sterile Miracloth filter cloth, wash it once with solution A, transfer the washed mycelium to 40 mL of protoplastization solution under aseptic conditions, and warm it at 30 °C and 200 rpm for 1 to 2 h. Protoplast transformation progress was detected by microscope observation.

[0031] Filter the above warm bath liquid with sterile Miracloth filter cloth, and the obtained filtrate is the protoplast solution. The protoplast solution was divided into two 50 mL sterile disposable centrifuge tubes, and the volume of each tube was made up to 45 m...

Embodiment 3

[0044] Example 3: Fermentation of Aspergillus niger aglu and expression of α-glucosidase

[0045] Pick the positive transformant Aspergillus niger aglu obtained in Example 2, inoculate it in 30 mL of TSB fermentation medium, and cultivate for 5 d at 30° C. and 200 rpm; at the same time, take the host bacterium Aspergillus niger G1 not transformed into the exogenous gene as The control group was cultivated under the same fermentation conditions as above; the fermentation broths of the obtained Aspergillus niger aglu and host bacteria Aspergillus niger G1 were filtered with 8 layers of gauze respectively, and the filtrate was centrifuged for 10 min under 14000g conditions, and the supernatant was collected; the above-mentioned supernatant was Electrophoresis was performed on a 12% SDS-PAGE gel.

[0046] The result is as figure 2 Swimming lane 1 shows the expression of the secreted protein of the host strain Aspergillus niger G1, and lanes 2-4 show the expression of the secrete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides alpha-glucosidase. The amino acid sequence of the alpha-glucosidase is SEQ ID NO:1. The optimum action temperature of the alpha-glucosidase is 60 DEG C; over 80% of enzyme activity can be retained in a range of 50-65 DEG C; the optimum action pH value is 4.5; over 80% of enzyme activity can be retained in a pH range of 3.0-6.0. The alpha-glucosidase is capable of efficiently converting maltose; the content of isomaltose, the content of panose and the content of isomaltotriose in a conversion product are the highest and respectively reach 44.1%, 23.0% and 21.2%; the total content of the isomaltose, the panose and the isomaltotriose is 88.3%. Therefore, the alpha-glucosidase can be widely applied to production of isomalto oligosaccharides and has a wide market prospect.

Description

Technical field [0001] The invention belongs to the technical field of genetic engineering, and specifically relates to an α-glucosidase and its application. Background technique [0002] α-glucosidase (α-glucosidase, referred to as AGLU enzyme, EC 3.2.1.20), also known as α-D-glucoside hydrolase, can cleave α-1 from the non-reducing end of oligosaccharide substrates, 4 glycosidic bonds, releasing glucose; or transferring the free glucose residues to another carbohydrate substrate to form α-1,6 glycosidic bonds, thereby forming non-fermentable functional oligosaccharides - oligosaccharides Isomaltose (referred to as IMOs, mainly including isomaltose, panose, isomalttriose, etc.). Industrially, alpha-glucosidase is mainly used in the mass production of isomaltooligosaccharide. Isomalto-oligosaccharide is a type of oligosaccharide containing at least one α-(1,6) glycosidic bond, mainly isomaltose, panose, and isomalttriose. It naturally exists in small amounts in soy sauce a...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/26C12N15/56C12N1/15C12P19/14C12P19/12C12R1/685
CPCC12N9/2402C12N15/80C12P19/00C12P19/12C12P19/14C12Y302/0102
Inventor王华明徐娟黄亦钧
OwnerQINGDAO VLAND BIOTECH GRP