Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Mangosteen glycosyltransferase gene UGT74AC1 and application thereof

A mogrosolic alcohol and amino acid technology, applied in the directions of transferase, application, genetic engineering, etc., can solve the problem of unclear glycosyltransferase and so on

Inactive Publication Date: 2015-03-11
TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
View PDF2 Cites 13 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] UGT74AC1 It is a member of the mogrosyl glycosyltransferase family, which was found in previous transcriptome studies including UGT74AC1 A large number of genes encoding glycosyltransferases that may be involved in the mogroside synthesis pathway (Tang, Qi, et al. An efficient approach to finding Siraitia grosvenorii triterpene biosynthetic genes by RNA-seq and digital gene expression analysis. BMC genomics 12.1 (2011): 343.), but it is not clear whether these glycosyltransferases are really related to the synthesis of mogroside
The existing literature search shows that there is no relevant glycosyltransferase at home and abroad UGT74AC1 Related reports on catalyzing sweet glycoside synthesis

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mangosteen glycosyltransferase gene UGT74AC1 and application thereof
  • Mangosteen glycosyltransferase gene UGT74AC1 and application thereof
  • Mangosteen glycosyltransferase gene UGT74AC1 and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0015] Embodiment 1, glycosyltransferase gene UGT74AC1 Cloning and construction of prokaryotic expression vector

[0016] The total RNA of Luo Han Guo was extracted according to the operation steps on the TRIzol (Invitrogen, USA ) kit, and then the extracted total RNA was used as a template to obtain the RNA of Luo Han Guo by reverse transcription using the First Strand cDNA Synthesis Kit (Ferments, USA ). total cDNA. According to the glycosyltransferase gene published on the NCBI (http: / / www.ncbi.nlm.nih.gov / ) database UGT74AC1 DNA sequence, design a pair of specific primers UGT74AC1-F:CGC CATATG CACCACCACCACCACCACATG

[0017] GAGAAAGGCGATACGCATATT and UGT74AC1-R:CGGAATTCTCAA

[0018] GTTTGCTTGAGCATGGCCAC Amplified UGT74AC1 full sequence. will get UGT74AC1 go through first Nde I and Eco After RI digestion, with the same Nde I and Eco The pET21a treated with RI double digestion was ligated to construct the expression vector pET21-UGT74AC1 (attached figure 1 )...

Embodiment 2

[0019] Example 2, Construction of Escherichia coli recombinant strain and expression and separation and purification of target protein

[0020] The expression vector pET21-UGT74AC1 with correct sequencing was transformed into the E. coli expression strain Rosetta gami (DE3), and the transformant was verified by colony PCR that the recombinant plasmid pET21-UGT74AC1 had entered the E. coli expression strain Rosetta gami (DE3) and then used for recombinant protein UGT74AC1 expression. Inoculate an appropriate amount of Escherichia coli transformants in LB medium supplemented with corresponding concentrations of ampicillin, kanamycin, chloramphenicol and streptomycin, and culture overnight at 37°C and 220 rpm. Then inoculate the overnight culture into fresh LB medium containing corresponding antibiotics at a ratio of 2:100, and culture at 37°C and 220 rpm until the cell OD 600 It is 0.6-0.8. Then IPTG was added to a final concentration of 0.1 mM, and cultured at 16°C and 150 rp...

Embodiment example 3

[0021] Implementation case 3, UGT74AC1 Determination of enzyme activity

[0022] Measured in 2 mL EP tubes UGT74AC1 enzyme activity. The reaction system is: 1 mM UDP-glucose, 0.2 mM mogrosinol, 100 μg UGT74AC1 Protein, 50 mM Tri-HCl (pH 7.2), reacted at 30°C for 4 h. Then the reaction product was extracted three times with an equal volume of ethyl acetate, and the extracted product was synthesized and dried with nitrogen. Finally, the product was dissolved in chromatographic grade methanol and processed through a 0.22 μm filter membrane for LC-MS analysis.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mangosteen glycosyltransferase gene (i)UGT74AC1( / i) and application of glycosyltransferase with a gene (i)UGT74AC1( / i) code in synthetic mogrosideIE. The glycosyltransferase gene (i)UGT74AC1( / i) has a nucleotide coding sequence shown in SEQIDNO.1 and a peptide sequence shown in SEQIDNO.2. By utilization of an expression of the mangosteen glycosyltransferase gene (i)UGT74AC1( / i) in escherichia coli, the recombinant glycosyltransferase (i)UGT74AC1( / i) can catalyze mogrol and UDP-glucose to react, thereby generating the mogrosideIE. The glycosyltransferase gene (i)UGT74AC1( / i) disclosed by the invention can be applied to the artificial synthesis of the mogrosideIE. Meanwhile, the gene has an important application value in the aspect of improving momordica grosvenori by the utilization of a transgenic technology to improve the content of the mogroside.

Description

technical field [0001] The invention relates to the field of biotechnology, more specifically to a new glycosyltransferase UGT74AC1 and its application in catalyzing mogroside IE from mogroside alcohol. Background technique [0002] Luo Han Guo is a vine deciduous plant of Cucurbitaceae ( Siraitia grosvenorii Swingle) is a precious medicinal and sweet plant unique to my country. It has been included in the Pharmacopoeia of the People's Republic of China since 1977 and is used as a commonly used traditional Chinese medicine. The Ministry of Health and the Administration of Traditional Chinese Medicine included Luo Han Guo in the first batch of "list of varieties that are both medicine and food". Luo Han Guo is extremely sweet in taste, cool in nature, and non-toxic. It has the functions of relieving cough and nourishing lungs, resolving phlegm and nourishing blood, laxative, and removing blood stasis (Prakash, Indra, and Venkata Sai Prakash Chaturvedula. Additional New Min...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12N9/10C12N15/63C12P33/20
Inventor 孙媛霞戴隆海张江生门燕朱玥明
Owner TIANJIN INST OF IND BIOTECH CHINESE ACADEMY OF SCI
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More