Mangosteen glycosyltransferase gene UGT74AC1 and application thereof
A mogrosolic alcohol and amino acid technology, applied in the directions of transferase, application, genetic engineering, etc., can solve the problem of unclear glycosyltransferase and so on
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0015] Embodiment 1, glycosyltransferase gene UGT74AC1 Cloning and construction of prokaryotic expression vector
[0016] The total RNA of Luo Han Guo was extracted according to the operation steps on the TRIzol (Invitrogen, USA ) kit, and then the extracted total RNA was used as a template to obtain the RNA of Luo Han Guo by reverse transcription using the First Strand cDNA Synthesis Kit (Ferments, USA ). total cDNA. According to the glycosyltransferase gene published on the NCBI (http: / / www.ncbi.nlm.nih.gov / ) database UGT74AC1 DNA sequence, design a pair of specific primers UGT74AC1-F:CGC CATATG CACCACCACCACCACCACATG
[0017] GAGAAAGGCGATACGCATATT and UGT74AC1-R:CGGAATTCTCAA
[0018] GTTTGCTTGAGCATGGCCAC Amplified UGT74AC1 full sequence. will get UGT74AC1 go through first Nde I and Eco After RI digestion, with the same Nde I and Eco The pET21a treated with RI double digestion was ligated to construct the expression vector pET21-UGT74AC1 (attached figure 1 )...
Embodiment 2
[0019] Example 2, Construction of Escherichia coli recombinant strain and expression and separation and purification of target protein
[0020] The expression vector pET21-UGT74AC1 with correct sequencing was transformed into the E. coli expression strain Rosetta gami (DE3), and the transformant was verified by colony PCR that the recombinant plasmid pET21-UGT74AC1 had entered the E. coli expression strain Rosetta gami (DE3) and then used for recombinant protein UGT74AC1 expression. Inoculate an appropriate amount of Escherichia coli transformants in LB medium supplemented with corresponding concentrations of ampicillin, kanamycin, chloramphenicol and streptomycin, and culture overnight at 37°C and 220 rpm. Then inoculate the overnight culture into fresh LB medium containing corresponding antibiotics at a ratio of 2:100, and culture at 37°C and 220 rpm until the cell OD 600 It is 0.6-0.8. Then IPTG was added to a final concentration of 0.1 mM, and cultured at 16°C and 150 rp...
Embodiment example 3
[0021] Implementation case 3, UGT74AC1 Determination of enzyme activity
[0022] Measured in 2 mL EP tubes UGT74AC1 enzyme activity. The reaction system is: 1 mM UDP-glucose, 0.2 mM mogrosinol, 100 μg UGT74AC1 Protein, 50 mM Tri-HCl (pH 7.2), reacted at 30°C for 4 h. Then the reaction product was extracted three times with an equal volume of ethyl acetate, and the extracted product was synthesized and dried with nitrogen. Finally, the product was dissolved in chromatographic grade methanol and processed through a 0.22 μm filter membrane for LC-MS analysis.
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap