Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Engineering strain-clonostachys rosea for perilipin gene transfer and application of engineering strain

A technology of lipid droplet coating protein and engineering strains, which is applied in application, microbe-based methods, fungicides, etc., can solve the problems of lack of highly pathogenic strains, unstable control effect of Clonosporium pink

Active Publication Date: 2015-05-13
INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The purpose of the present invention is to provide a translipid droplet coating protein gene Clonospora pink helix engineering strain and its application, to solve the lack of highly pathogenic strains in the prior art and the existing unstable control effect of Clonospora pink helix question

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Engineering strain-clonostachys rosea for perilipin gene transfer and application of engineering strain
  • Engineering strain-clonostachys rosea for perilipin gene transfer and application of engineering strain

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Construction of lipid droplet-coated protein transformation vector

[0026] Using 3′-Full RACE Core Set Ver.2.0 and 5′-Full RACE Kit kits, respectively, the cDNA sequence fragment of the lipid droplet coating protein gene was amplified by 3′RACE and 5′RACE, and the two amplified products were cloned To the pMD19-T vector, sequencing, splicing, obtaining the full-length Per3 cDNA, and performing PCR verification; using specific primers Per3F: 5′-3′GAAACTTCTCTTTCGTCTCTATCGA and Per3R: CTTGCAAGCACAGAAAGAAAATCAA to amplify to obtain the full-length Per3 gene, GenBank accession number KF269990;

[0027] The transformation vector is pAN7-1 eukaryotic expression vector (provided by the Chinese Academy of Sciences Microbiology), which contains eukaryotic promoter gene gpda, hygromycin resistance marker gene hph and terminator gene trpC. 采用PCR扩增启动子、终止子和脂滴包被蛋白基因片段,引物分别为:(5′-3′)gpdaF:ACTCGACCTGCAGGCATGCAAGCTTGAATTCCCTTGTATCTCTACACA,gpdaR:ACCAATCCAAAAGCCTACTCTGAAGGGAAAAGAAAGAGAAAAGA...

Embodiment 2

[0031] Transformation of recombinant vector pAN7-1-per3

[0032]Clonospora rosea HLD-1 was inoculated on PDA medium and cultured for 10 days, 5 ml of sterile water was added to elute the spores, 1 ml was drawn and inoculated into PD culture medium, and cultured at 26°C for 12 hours with shaking at 160 r / min. The hyphae were collected with a sterilized 500-mesh sieve, the nutrients were washed out with sterile water, and then rinsed with 0.7M NaCl osmotic pressure stabilizer to make it equilibrated. Pick a small amount of mycelium, put it into a solution containing 40mg / ml helicase, vortex to disperse it, enzymolyze it at 100r / min at 28°C for 3h, add an equal volume of osmotic pressure stabilizer to dilute to avoid excessive enzymolysis. 500-mesh sieve to remove cell debris, transfer the filtrate to a 50ml centrifuge tube, centrifuge at 4000r / min for 10min, discard the supernatant, STC solution (sucrose 200g / L, 1M Tris-HCL 50ml / L, calcium chloride 5.55g / L ) to suspend the sedi...

Embodiment 3

[0036] Determination of Gene Expression of Lipid Droplet Coating Protein in Engineering Strain Cr-per44

[0037] Real-time quantitative PCR method was used to measure the expression of lipid droplet coating protein in engineering strain Cr-per44, and elongation factors (Elongation factors) were used as internal reference genes. The elongation factor and Per3-specific primers were designed using Primer5 software, respectively. EFF: TCGATGTCGCTCCTGACT, EFR: AGCGTGACCGTTTATTTGA, Per3F: GAAACTTCTCTTTCGTCTCTATCGA, Per3R: CTTGCAAGCACAGAAAGAAAATCAA. The cDNA samples were diluted 10 times, and the SYBR Green method was used for fluorescence quantitative determination. The reaction system is: SYBR Premix 12.5 μl, cDNA template 2 μl, upstream and downstream primers 1 μl each, and ddH 2 O 8.5 μl. The reaction conditions were: denaturation at 95°C for 2 min, followed by 40 cycles of the following reactions: denaturation at 95°C for 10 s and annealing at 60°C for 30 s. The calculation ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an engineering strain-clonostachys rosea for perilipin gene transfer and an application of the engineering strain. The engineering strain is named as Cr-per44, has a preservation registration number of CGMCC (China General Microbiological Culture Collection Center) No.10028 in the CGMCC, is obtained by transferring a parasitic related gene-perilipin gene Per3 into clonostachys rosea HLD-1 through protoplast transformation, is strong in disease resistance and stable in prevention effect, can effectively prevent and control sclerotinia and gray mold of crops, and has relatively good prevention and control effects on various plant fungous diseases such as blight and root rot.

Description

technical field [0001] The invention belongs to the technical field of bioengineering and biological control, in particular to an engineering bacterial strain of Clonosporium pinkhelix translipid droplet coating protein gene. Background technique [0002] Clonostachys rosea, formerly known as: Gliocladium roseum, is an important type of fungal parasite, which can infect Sclerotinia, Botrytis cinerea, Fusarium and Rhizoctonia by winding, puncturing, etc. A variety of plant pathogenic fungi can also produce antibacterial substances to inhibit the growth of pathogenic bacteria, promote plant growth, and induce plant resistance, so they have great biocontrol potential. However, the lack of highly pathogenic strains in the prior art and the lack of large-scale cultivation technology of excellent strains are the key factors restricting its wide application in the field of plant disease control. [0003] The prior art shows that lipases play an important role in plant disease resi...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12N15/80A01N63/04A01P3/00C12R1/645
CPCA01N63/30C07K14/415C12N15/80
Inventor 孙漫红孙占斌李世东
Owner INST OF PLANT PROTECTION CHINESE ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com