Fungus genetic screening method based on marker gene

A technology of fungi and genes, which is applied in the field of microbial genetic transformation engineering, can solve problems such as the inability to study double genes or multiple genes, and the limited range of use of screening marker genes, and achieve the effect of biological safety and low cost

Inactive Publication Date: 2015-08-19
HAINAN UNIVERSITY +1
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] The technical problem to be solved by the present invention is: in view of the limited number of fungal screening marker genes or the limited range of use of known screening marker genes, it is impossible to carry out transformation research on double genes or multiple genes. Pathway key genes as marker genes for fungal screening

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fungus genetic screening method based on marker gene
  • Fungus genetic screening method based on marker gene
  • Fungus genetic screening method based on marker gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Example 1: Obtaining the PBS2 gene deletion mutant of Colletotrichum gloeosporioides

[0037] (1) Cloning of the PBS2 gene of Colletotrichum gloeosporioides

[0038] Search the known fungal HOG1 MAPK signal pathway key gene PBS2 gene sequence in the GenBank database (accession number: NP_012407). Search for homologous genes (Colletotrichum graminicola (M.1.001): GLRG_07565.1; Colletotrichum higginsianum) in the published anthrax genome database (http: / / www.broadinstitute.org / annotation / genome / colletotrichum_group / MultiHome.html) (IMI 349063): CH063_12338.1). Design primer pairs SEQ ID NO:1 and SEQ ID NO:2. The PCR method was used to amplify and clone in Colletotrichum gloeosporioides and sequenced to obtain the PBS2 gene sequence SEQ ID NO: 3.

[0039] Table 1: Sequence information involved in the present invention

[0040] Name

Sequence information

PBS2-OF (SEQ ID NO:1)

CCCAAGCTTATGGCAGACATCAACACCCCC

PBS2-OR (SEQ ID NO: 2)

GCCGAATTC TTCCAACCTGTTCTCCGAGCC

PBS2 g...

Embodiment 2

[0051] Example 2: Determination of permeability and salt tolerance of the PBS2 gene deletion mutant of Colletotrichum gloeosporioides

[0052] CgPBS2 gene affects the salt stress function of Colletotrichum gloeosporioides: A comparative analysis of the growth of the wild strain of Colletotrichum gloeosporioides and the gene knockout mutant △PBS2-8 on the medium containing high concentration of NaCl. The results showed that the gene deletion mutant grew slowly in a medium containing high concentration of salt (see Figure 4 ), indicating that the PBS2 gene deletion mutant is sensitive under high salt conditions. It is confirmed that high-salt medium (PDA+1M NaCl) can be used as a screening medium.

[0053] CgPBS2 gene regulates the function of Colletotrichum gloeosporioides against osmotic pressure: Comparative analysis of the wild strain of Colletotrichum gloeosporium and the gene knockout mutant △PBS2-8 grow on the medium containing glucose, sucrose and sorbitol. Gene deletion mu...

Embodiment 3

[0054] Example 3: Using △PBS2-8 as the recipient bacteria and PBS2 gene as the selection marker gene, GFP gene was transformed.

[0055] First, the pSK-PBS2-GFP expression vector needs to be constructed. Using pBluescript Sk+ as the vector backbone, use SalI / ClaI and BamHI / XbaI to connect the promoter (from pCSN43 (C.Staben, 1989)) and terminator (from pAN7-1) of the gene trpC, and then use the primer pair GFP -F / GFP-R was amplified from the vector pSULF·gfp to obtain the PCR product fragment of eGFP, which was connected with PstI / BamHI double enzyme digestion ligation method to obtain pSK-G (see figure 2 ). The primer pair PBS2-OF / PBS2-OR was used to amplify the ORF sequence of Colletotrichum gloeosporioides PBS2 gene (without terminator), and it was connected to pSK-G by Hind3 / EcoRI double enzyme digestion method to obtain pSK-CgPBS2-GFP.

[0056] As in Example 1, using PEG-mediated transformation of protoplasts, the plasmid pSK-CgPBS2-GFPLF was introduced into the △PBS2-8 gene...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a fungus genetic screening method based on a marker gene. The method comprises the following steps of cloning an acceptor fungus HOG1 MAPK signal pathway key gene, establishing an acceptor fungus HOG1 MAPK signal pathway key gene knock-out vector, acquiring an acceptor fungus HOG1 MAPK signal pathway key gene knock-out mutant, determining permeability resistance and salt resistance of the acceptor fungus HOG1 MAPK signal pathway key gene knock-out mutant, and verifying the transformation by adopting the acceptor fungus HOG1 MAPK signal pathway key gene as a screening marker. By adopting the method, the source of the fungus genetic transformation screening marker is enriched, when the acceptor fungus does not have a plurality of screening markers, the requirement for carrying out the double-gene or multi-gene functional research can be met.

Description

Technical field [0001] The invention relates to the field of microbial genetic transformation engineering. Specifically, the present invention relates to a fungal genetic screening method based on selection marker genes. Background technique [0002] Fungi are widely distributed in nature and are closely related to human production and life. They play an important role in agriculture, industry, medicine, health care and scientific research. DNA genetic transformation is an important way for people to carry out strain improvement, useful gene cloning and gene function research. Since Mishra and Tatum first reported the successful transformation of DNA by Neurospora crassa in 1973, the research on the genetic transformation of filamentous fungi has progressed very rapidly. The current filamentous fungal transformation methods mainly include the following: (1) CaCl2-PEG-mediated protoplast transformation; (2) electroporation transformation; (3) gene gun transformation; (4) restric...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68C12Q1/04C12N1/14
CPCC12Q1/6895
Inventor林春花黄贵修郑服丛缪卫国刘文波
OwnerHAINAN UNIVERSITY