Saccharifying enzyme high-yield strain gene knockout recombinant bacteria with low trans-glycoside enzyme background as well as construction method and application thereof

A high-yield, gene-knock-out technology for glycosylase, applied in the direction of glycosylase, recombinant DNA technology, enzymes, etc., can solve the problem of undocumented glycosylase

Active Publication Date: 2016-09-28
SOUTH CHINA UNIV OF TECH
View PDF2 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, there is no record in this patent that the deletion of the α-glucosidase genes agdB, agdA and agdE can effectively improve the activity of glucoamylase

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Saccharifying enzyme high-yield strain gene knockout recombinant bacteria with low trans-glycoside enzyme background as well as construction method and application thereof
  • Saccharifying enzyme high-yield strain gene knockout recombinant bacteria with low trans-glycoside enzyme background as well as construction method and application thereof
  • Saccharifying enzyme high-yield strain gene knockout recombinant bacteria with low trans-glycoside enzyme background as well as construction method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Example 1 Construction of Aspergillus niger α-glucosidase gene knockout vector

[0066]Using the Aspergillus niger SH-2 genome as a template, use primers Upstream-F and Upstream-R, Redown-F and Redown-R, Downstream-F and Downstream-R respectively to amplify to obtain an Upstream fragment of about 1000bp (to be The upstream homology arm of the gene to be knocked out), the Redown fragment of about 500bp (the partial repeat sequence of the downstream homology arm of the gene to be knocked out) and the Downstream fragment of about 1000bp (the downstream homology arm of the gene to be knocked out); to construct Aspergillus nidulans (Aspergillus nidulans) genome was used as a template, and a 1398bp pyrG fragment (as shown in the sequence SEQ ID NO: 8 in the sequence listing) was amplified with primer pairs pyrG-F and pyrG-R. After the gel was recovered, it was used as an Upstream fragment, Redown fragment and pyrG fragment were used as templates, and Upstream-F and pyrG-R wer...

Embodiment 2

[0067] Example 2 Transformation and screening of homologous recombination knockout target gene

[0068] 1. Preparation of protoplasts: in CD liquid medium (glucose 2%; NaNO 3 0.3%; KCl 0.2%; MgSO 4 ·7H 2 O0.05%; KH 2 PO 4 0.001%; ​​agarose 0.05%; pH5.5; after sterilization, add 1 × uridine) to cultivate Aspergillus niger mycelia, and transfer to YPD liquid medium (peptone 2%; yeast powder 1 %; glucose 2%; add 1× uridine after sterilization). The mycelium balls were filtered from the culture medium with double-layer filter paper and washed with 0.8M NaCl. v), 1% helicase (w / v) and 0.5% lysozyme (w / v) in the enzymolysis solution. 30°C, 100rpm enzymatic hydrolysis for 1.5-3h. Then place the enzymatic hydrolysis solution containing protoplasts on ice, filter through four layers of lens paper and rinse with 5mL NaCl four times. The filtrate was centrifuged at 900×g at 4°C for 10 min, and the supernatant was discarded; with 20 mL of STC (10 mM Tris-HCl; 1.2 M sorbitol; 50 ...

Embodiment 3

[0070] Example 3 Construction of Aspergillus niger SH-2: Δ1 and Aspergillus niger SH-2: ΔpyrGΔagdB strains and their functional identification (knockout gene agdB)

[0071] 1. Construction of Aspergillus niger SH-2:Δ1 and Aspergillus niger SH-2:ΔpyrGΔagdB strains

[0072] 1. Construction of knockout vector

[0073] (1) The relevant primer sequences for the construction of the agdB gene knockout vector are as follows:

[0074] Primer name

Sequence (5'→3')

Upstream(agdB)-F add EcoR V

gatatcTGCGCCTCAGTACTTGGGAG

Upstream(agdB)-R

ccctgtcaatggcaa ATCCCAGCTGGGTGGTCCCAGC

Redown(agdB)-F

ccaccccagctgggat TTGCCATTGACAGGGTTAGTG

Redown(agdB)-R

tctcgaggaagttgc GCTCGCCGGTCTGGCTTTG

pyrG(agdB)-F

gccagaccggcgagc GCAACTTCCTCGAGAACGCGC

pyrG(agdB)-R

cactaaccctgtcaatggcaa CCCTTTTAGTCAATACCG

Downstream(agdB)-F

cggtattgactaaaaggg TTGCCATTGACAGGGTTAGTG

Downstream(agdB)-R add EcoR V

ga...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses saccharifying enzyme high-yield strain gene knockout recombinant bacteria with low trans-glycoside enzyme background as well as a construction method and application thereof and belongs to the technical field of biology. The recombinant bacteria are obtained by inactivating one or more genes relevant to alpha-glucose trans-glycoside enzyme expression. Experiments prove that a new strain with low trans-glycoside enzyme activity is obtained by performing gene engineering reconstruction on aspergillus niger pyrG defect-type Aspergillus niger SH-2:delta pyrG with high saccharifying enzyme yield, and inactivating genes agdB, agdA and agdE. Compared with an initial strain, the strain has the advantages that the activity of saccharifying enzyme produced by fermentation of the strain is increased by 33%, the enzyme activity of alpha-glucose trans-glycoside enzyme is reduced by at least 43%, a separation and purification process for removing trans-glycoside enzyme from fermentation liquid is simplified, the production cost is lowered, and the recombinant bacteria have certain innovativeness and relatively great significance in development.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a gene-knockout recombinant bacterium of a glycoamylase high-producing bacterium with a low transglycosidase background and its construction and application. Background technique [0002] Glucoamylase, the system name is 1,4-α-D-glucan glucohydrolase (EC 3.2.1.3), also known as glucoamylase, is an exoglycosidase that can catalyze starch or related oligosaccharides D-glucose is released from the non-reducing ends of sugar and polysaccharide molecules. Commercially, glucoamylase is often used to convert corn starch that has been partially hydrolyzed to glucose by α-amylase, and is the main enzyme preparation in the starch processing industry. In recent years, the activity and yield of domestically produced glucoamylases have made great progress, but there is a problem of high α-glucosidase activity among glucoamylases. [0003] Aspergillus niger SH-2 is a high-yielding gl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/15C12N15/80C12N15/65C12N9/34C12R1/685
CPCC12N9/2408C12N9/2428C12N15/65C12N15/80C12Y302/01003C12Y302/0102
Inventor潘力杨海燕王斌
OwnerSOUTH CHINA UNIV OF TECH