Bacillus amyloliquefaciens with enhanced algae lysing capacity and application thereof
A technology of amylolytic spores and Bacillus subtilis, applied in the field of microorganisms, can solve the problems of low ratio, time-consuming, difficult to obtain ideal algae-dissolving bacteria, etc., and achieve the best effect of killing algae
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0028] Embodiment 1 Obtaining of algicidal polypeptide
[0029] (9) Cultivate Stenotrophomonas maltophilia, cultivate at 30°C and 200r / min for 20 hours to obtain a culture solution; centrifuge to remove bacteria and large particles of impurities;
[0030] (10) The centrifuged supernatant is pretreated with acetone to reduce the impurity content;
[0031] (11) The treated sample was subjected to isoelectric focusing IEF under non-denaturing conditions. After IEF, two IEF strips of the same width were cut from the gel, and the second dimension of polypropylene was carried out after equilibrating in buffer A. Amide gel electrophoresis, using acrylamide and methylene bisacrylamide to prepare non-denaturing gels, the components of the upper tank buffer are Tris-base, Tricine and SDS, and constant voltage electrophoresis until the front of bromophenol blue reaches the bottom;
[0032] (12) Treat the two gels obtained by PAGE separately, one gel was stained with Coomassie Brilliant ...
Embodiment 2
[0037] Example 2 Construction of genetic engineering bacteria Bacillus amyloliquefaciens
[0038] The P43 promoter gene was amplified by PCR using Bacillus subtilis (Bacillus subtilis) ATCC 9943 genomic DNA as a template to obtain a 300bp gene fragment; the amplification primers were P43-F~5'GCGAGCTCTGATAGGTGGTATGTTTTCGC3'-SacI; P43-R 5'GCGGGATCCCATGTGTACATTCCTCTCTT3'- Bam HI.
[0039] The P43 promoter gene fragment was obtained after double digestion with BernHI / SeicI, and the PHCMC04 vector (purchased from Bacillus genetic stock center, ECE189P) that had undergone the same double digestion treatment was connected with T4 DNA ligase to construct the pHCMC-P43 vector, digested After the verification is correct, store it at -20°C for later use;
[0040] The corresponding nucleotide sequences of VVRSPPRMWVTYKHMMIPPNQ or YRCWLQSKCTMCRDGQWPA were synthesized in Shanghai Sangong, with BamH / SmaI restriction sites at both ends. The SJT fragment was obtained after double digestion w...
Embodiment 3
[0044] Example 3 Detection of algae-dissolving activity
[0045] 1. Preparation of fermentation supernatant
[0046] The Bacillus amyloliquefaciens was fermented and cultured, and the Bacillus fermentation broth was centrifuged at 12000 rpm at 4°C for 10 minutes to collect the supernatant, which was the fermentation supernatant. Add sterilized water to the centrifuged bacteria to restore the original volume, namely the bacteria suspension.
[0047] 2. The cultivation of algae
[0048] The purchased Microcystis aeruginosa, Microcystis blooms, Microcystis candidida and Akashio algae species were cultured statically in a light incubator at 2000LX and 25°C, and artificially shaked once every 3h (average Carry out under sterile conditions), continue to pre-cultivate for one week, and check for the presence or absence of miscellaneous algae and the growth of algae under a microscope. If the synchronous and good growth is achieved, it can be used as the algae seed solution for the ...
PUM

Abstract
Description
Claims
Application Information

- R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com