Supercharge Your Innovation With Domain-Expert AI Agents!

Bacillus amyloliquefaciens with enhanced algae lysing capacity and application thereof

A technology of amylolytic spores and Bacillus subtilis, applied in the field of microorganisms, can solve the problems of low ratio, time-consuming, difficult to obtain ideal algae-dissolving bacteria, etc., and achieve the best effect of killing algae

Active Publication Date: 2016-11-23
鲁娇霞 +2
View PDF7 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the relatively low ratio of algicidal bacteria in natural water bodies, the traditional method needs to concentrate a large number of water samples, which takes a long time and is difficult to obtain ideal algicidal bacteria

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Bacillus amyloliquefaciens with enhanced algae lysing capacity and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Embodiment 1 Obtaining of algicidal polypeptide

[0029] (9) Cultivate Stenotrophomonas maltophilia, cultivate at 30°C and 200r / min for 20 hours to obtain a culture solution; centrifuge to remove bacteria and large particles of impurities;

[0030] (10) The centrifuged supernatant is pretreated with acetone to reduce the impurity content;

[0031] (11) The treated sample was subjected to isoelectric focusing IEF under non-denaturing conditions. After IEF, two IEF strips of the same width were cut from the gel, and the second dimension of polypropylene was carried out after equilibrating in buffer A. Amide gel electrophoresis, using acrylamide and methylene bisacrylamide to prepare non-denaturing gels, the components of the upper tank buffer are Tris-base, Tricine and SDS, and constant voltage electrophoresis until the front of bromophenol blue reaches the bottom;

[0032] (12) Treat the two gels obtained by PAGE separately, one gel was stained with Coomassie Brilliant ...

Embodiment 2

[0037] Example 2 Construction of genetic engineering bacteria Bacillus amyloliquefaciens

[0038] The P43 promoter gene was amplified by PCR using Bacillus subtilis (Bacillus subtilis) ATCC 9943 genomic DNA as a template to obtain a 300bp gene fragment; the amplification primers were P43-F~5'GCGAGCTCTGATAGGTGGTATGTTTTCGC3'-SacI; P43-R 5'GCGGGATCCCATGTGTACATTCCTCTCTT3'- Bam HI.

[0039] The P43 promoter gene fragment was obtained after double digestion with BernHI / SeicI, and the PHCMC04 vector (purchased from Bacillus genetic stock center, ECE189P) that had undergone the same double digestion treatment was connected with T4 DNA ligase to construct the pHCMC-P43 vector, digested After the verification is correct, store it at -20°C for later use;

[0040] The corresponding nucleotide sequences of VVRSPPRMWVTYKHMMIPPNQ or YRCWLQSKCTMCRDGQWPA were synthesized in Shanghai Sangong, with BamH / SmaI restriction sites at both ends. The SJT fragment was obtained after double digestion w...

Embodiment 3

[0044] Example 3 Detection of algae-dissolving activity

[0045] 1. Preparation of fermentation supernatant

[0046] The Bacillus amyloliquefaciens was fermented and cultured, and the Bacillus fermentation broth was centrifuged at 12000 rpm at 4°C for 10 minutes to collect the supernatant, which was the fermentation supernatant. Add sterilized water to the centrifuged bacteria to restore the original volume, namely the bacteria suspension.

[0047] 2. The cultivation of algae

[0048] The purchased Microcystis aeruginosa, Microcystis blooms, Microcystis candidida and Akashio algae species were cultured statically in a light incubator at 2000LX and 25°C, and artificially shaked once every 3h (average Carry out under sterile conditions), continue to pre-cultivate for one week, and check for the presence or absence of miscellaneous algae and the growth of algae under a microscope. If the synchronous and good growth is achieved, it can be used as the algae seed solution for the ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses bacillus amyloliquefaciens with enhanced algae lysing capacity and application thereof. According to the strain, SZ polypeptide with algae lysing capacity is guided based on known bacillus amyloliquefaciens, so that the bacillus amyloliquefaciens has the enhanced algae lysing effect and activity. Harmful algae can be effectively killed through fermentation supernatant. An application method of the strain is simple, the supernatant is prepared into powder or tablets through a conventional method, and the powder or the tablets can be put in water at any time according to requirements. Meanwhile, the bacterial liquid is good in safety and can be used and popularized on a large area.

Description

technical field [0001] The invention belongs to the field of microorganisms, and in particular relates to a strain of bacillus amyloliquefaciens with algae-dissolving ability and its application. Background technique [0002] With the rapid development of social economy and urbanization in our country, a large amount of urban domestic sewage, industrial wastewater and agricultural non-point source pollution are discharged into rivers and lakes, which accelerates the process of water pollution and eutrophication. Frequent outbreaks of toxic cyanobacteria (mainly Microcystis) blooms in lakes such as Taihu Lake, Chaohu Lake, and Dianchi Lake have endangered tap water supply and drinking water safety in many large and medium-sized cities. Microcystis blooms can cause water quality to deteriorate and stink, and the microcystin released is a heptapeptide, which is very stable (boiling cannot inactivate it) and highly toxic. Studies have shown that microcystins may be associated w...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/21A01N63/02A01N47/44A01N25/12A01N25/34A01P13/00C02F3/34C12R1/07
CPCA01N25/12A01N25/34A01N47/44A01N63/10C02F3/34C07K7/08C07K14/00A01N2300/00
Inventor 苏永鹏
Owner 鲁娇霞
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More