Targeting vector with swine ApoE gene knocked out as well as construction method and applications of targeting vector

A targeting vector and gene knockout technology, applied in the field of genetic engineering, can solve the problems of difficult experimental operation, high experimental cost, inconvenient research, etc., and achieve the effect of improving the enrichment efficiency.

Inactive Publication Date: 2017-02-15
CHINA AGRI UNIV
View PDF3 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, As occurs in various locations; the cost of the experiment is expensive and the experiment operation is difficult; and it involves ethical issues, which brings inconvenience to the research

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Targeting vector with swine ApoE gene knocked out as well as construction method and applications of targeting vector
  • Targeting vector with swine ApoE gene knocked out as well as construction method and applications of targeting vector
  • Targeting vector with swine ApoE gene knocked out as well as construction method and applications of targeting vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] Example 1 Construction of porcine ApoE gene knockout targeting vector

[0044] Include the following steps:

[0045] Step 1: Transform the targeting vector pLoxPneo (ie ploxp) by enzyme cutting-ligation method, and introduce the negative selection gene DTA to obtain the vector ploxp-DTA.

[0046]Step 2: Using the high-fidelity PCR method to use the genomic DNA of minipigs as a template, amplify a 2.4kb fragment as the 5' homology arm, and simultaneously amplify a 5.7kb fragment as the 3' homology arm, and connect the PCR products Sequencing in the T vector, the nucleotide sequence of the 5' homology arm is shown in SEQ ID NO:1, and the nucleotide sequence of the 3' homology arm is shown in SEQ ID NO:2.

[0047] The primer sequence for amplifying the 5' homology arm is as follows (5'-3'):

[0048] SARM-F: GAATTCAGGCTTTGGTTCCAGAGTTCACAG

[0049] SARM-R: GTCGACAGGCAACAACGCATTAGAAACAG

[0050] Among them, the underlines are the restriction sites of EcoRI and SalI respec...

Embodiment 2

[0057] Example 2 Transfection of pig fetal fibroblasts and cell screening and identification

[0058] Using a nucleic acid transfection instrument produced by Lonza, Germany, 3 μg of the linearized targeting vector ApoE KO II was transferred into pig fetal fibroblasts.

[0059] After 48 hours of cell transfection, the cells were digested from the T75 cell culture flask by trypsinization method, and each 100mm cell culture dish was connected with 4×10 5 Cells were selected for 7-9 days with G418 concentration of 500 μg / mL cell culture medium.

[0060] Cell clones with G418 resistance were selected with a cell cloning ring and inoculated into 48-well cell culture plates. After the cells were cultured to 80% confluence, after trypsinization, they were inoculated into 12-well cell culture plates to continue culturing. The original 48 The undigested cells in the well cell culture plate were also continued to be cultured for the extraction of cellular genomic DNA, and then the cell...

Embodiment 3

[0073] Example 3 Production and Identification of Homozygous Transgenic Cloned Pigs

[0074] 1. Production of transgenic cloned pigs

[0075] 1) In vitro maturation of porcine oocytes: Take the ovary from the slaughterhouse, put it in the normal saline containing penicillin and streptomycin sulfate at 28°C-35°C, transport it back to the laboratory within 2 hours, and use a 20-gauge needle equipped with a 18-gauge needle Aspirate follicles with a diameter of 3-6 mm on the ovary with a 3-ml syringe, put the extracted solution in a 50-ml centrifuge tube, let it stand in a water bath at 37°C for 15 minutes, remove the supernatant, add HEPES to resuspend the precipitate, and let it stand for 15 minutes. Repeat once more, put the resuspension into a plastic petri dish with a diameter of 60 mm, and under a stereomicroscope, use a mouth pipette to select cumulus cell-oocyte complexes with more than 2 layers of cumulus wrapping, dense and uniform cytoplasm, Wash 3 times with the matur...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a targeting vector with the swine ApoE gene knocked out as well as a construction method of the targeting vector. The targeting vector takes the carrier pLoxPneo as a skeleton carrier, and comprises a positive screening component, a negative screening marker gene and the 5' homologous arm and 3' homologous arm of the swine ApoE gene. The invention further provides applications of the targeting vector in preparing animal models with the swine ApoE gene knocked out. With the adoption of the method provided by the invention, the healthy homozygote miniature pig with the ApoE gene knocked out is successfully obtained, therefore, a foundation is laid for the development of the novel medicines for treating cardiovascular diseases, and meanwhile, a guarantee is provided for developing pathological study, drug screening, efficacy evaluation and the like.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to a porcine ApoE gene knockout targeting vector and its construction method and application. Background technique [0002] The main principle of gene targeting technology is that homologous recombination can occur between the exogenous DNA sequence and the homologous DNA sequence on the chromosome of the recipient cell, and this technology can carry out targeted fine modification of the genome. Since the first somatic cell gene targeting cloned sheep was born in 2000, somatic cell gene targeting technology combined with nuclear transfer technology has been widely used in targeted fine modification of large animal genomes. [0003] Apolipoprotein E (apolipoprotein E, ApoE) is a polymorphic protein that participates in the transformation and metabolism of lipoproteins. Apolipoprotein E mainly exists in CM, VLDL, IDL and some HDL. The concentration of ApoE in normal human ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/65C12N15/66C12N15/877C12N5/10A01K67/027
CPCC12N15/8509A01K67/0276A01K2217/075A01K2227/108A01K2267/0375C07K14/775C12N5/0603C12N15/65C12N15/66C12N15/8778
Inventor李秋艳李宁李向清刘原武温啸李燕宋慧霞李志远张在虎张久明李向东
OwnerCHINA AGRI UNIV