Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Large-scale production method of high-purity perdeuterated protein

A production method and large-scale technology, applied in the biological field, can solve problems such as the impossibility of chemical labeling, and achieve the effects of shortening purification time, simplifying purification process, and reducing cleaning volume

Inactive Publication Date: 2018-03-09
SHANGHAI JIAO TONG UNIV
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Among them, the chemical culture method can only replace parts, especially for biological macromolecules, because they generally have complex spatial structures and hydrophobic cores, and it is almost impossible to obtain fully deuterated proteins by chemical labeling methods. Therefore, they can only rely on metabolism. Notation

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Large-scale production method of high-purity perdeuterated protein
  • Large-scale production method of high-purity perdeuterated protein
  • Large-scale production method of high-purity perdeuterated protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0090] Example 1: Construction of recombinant PET28a-CYP101 vector

[0091] 1. Template: extract Pseudomonas putida (Pseudomonas putida, preservation number is 700412 TM ) whole genome, used as a template for PCR amplification reactions.

[0092] 2. PCR amplification: using the whole genome of Pseudomonas putida as a template, the amplification product is obtained through PCR amplification reaction;

[0093] Among them, the designed upstream and downstream primer sequences are respectively:

[0094] Upstream primer F: CCGCCATGGCGATGGTTCCCAGCGACCTGTATC

[0095] Downstream primer R: GCGGCGGCCGCCTCGCTGTCAAACTTAATAGPCR

[0096] 3. Digestion: Digest the amplified product (the gene fragment obtained in step 2) and the prokaryotic expression vector pET28a with NcoI (NEB#R0193) and XhoI (NEB#R0146) at the same time, and recover the gene PCR product and pET-28a respectively Carrier digested fragments.

[0097] 4. The target gene fragment was ligated with the vector: T4 DNA ligas...

Embodiment 2

[0102] Example 2: Production of CYP101 strains grown in common medium

[0103] 1. Bacterial transformation: Transform 2 μl of the recombinant plasmid PET28a-CYP101 into Escherichia coli BL21-plysS competent bacteria, and streak it on the Khanna antibiotic LB solid medium plate, and place it in a constant temperature incubator at 37°C for 12-16 hours.

[0104] 2. Seed culture: Pick a single clone colony and place it in a test tube of 5 ml LB liquid medium for shaking culture at 37° C., and shake it at 250 rpm overnight.

Embodiment 3

[0105] Example 3: The bacterial strain producing CYP101 gradually adapts to the growth process in the deuterated medium

[0106] 1 Plate culture: Dilute the above-mentioned activated overnight bacteria by 1000 times, take an appropriate amount and spread it evenly on a solid culture dish with a coating stick, in which the medium is 25% deuterated solid medium, place it in a biochemical incubator at 37°C, and observe Cultivate for more than 15 hours until relatively obvious monoclonal colonies grow.

[0107] 2. Test tube culture: Pick the colony of the above monoclonal colony and culture it in a test tube of 5 ml of 25% deuterated medium at 37° C. with shaking at 250 rpm until the culture medium is relatively turbid.

[0108] 3. Carry out plate culture with the same operation as 1, at this time, the medium is 50% deuterated solid medium.

[0109] 4. Carry out test tube culture with the operation in 2. At this time, the medium is a 50% deuterated liquid medium.

[0110] 5. Sam...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a large-scale production method of high-purity perdeuterated protein, and belongs to the technical field of biology. The large-scale production method includes steps of structuring escherichia coli engineering bacteria capable of expressing a target protein, and culturing the escherichia coli engineering bacteria capable of expressing a target protein in a culture medium with different deuterated ratios, so as to obtain a bacterial strain capable of completely adapting to the perdeuterated culture environment; making the bacterial strain capable of completely adaptingto the perdeuterated culture environment grown at the deuterated culture medium on a large scale, and expressing the targeted protein; purifying the expressed target protein to obtain the perdeuterated target protein. The invention provides a method for preparing and purifying the perdeuterated biomacromolecule protein. On the one hand, the method has guiding significance to isotope labeling of cell culture in vivo of biomacromolecule like protein, polypeptide, nucleic acid and others; meanwhile, the deuterated biological samples are significantly applied to many research methods such as magnetic resonance imaging, neutron scattering, mass spectrum and other aspects; the large-scale production of the purified and perdeuterated biomolecular enzyme has wide application prospect.

Description

technical field [0001] The invention belongs to the field of biotechnology, and in particular relates to a technical means for cultivating Escherichia coli using a fully deuterated culture medium and utilizing fully deuterated engineering bacteria to produce and purify fully deuterated proteins. Background technique [0002] Cytochrome P450 (cytochrome P450, referred to as CYP450) is a superfamily of heme-thiolate proteins, which widely exist in various organisms in nature. Metabolism of xenobiotics. Its participation process can be roughly divided into three aspects: the synthesis of hormone substances in the body, the metabolism of exogenous substances and the decomposition of fatty acids. They were first discovered by Garfinkel and Klingenberg from mammalian liver microsomes in 1958. They were named because they can bind CO in a reduced state and detect an obvious absorption peak at a wavelength of 450nm after binding. Cytochrome P450 enzymes. Molecular biology techniq...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N15/70C12R1/19
CPCC12N9/0053C12N15/70C12Y109/03001
Inventor 黄娟洪亮刘卓
Owner SHANGHAI JIAO TONG UNIV
Features
  • Generate Ideas
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com