Large-scale production method of high-purity perdeuterated protein
A production method and large-scale technology, applied in the biological field, can solve problems such as the impossibility of chemical labeling, and achieve the effects of shortening purification time, simplifying purification process, and reducing cleaning volume
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0090] Example 1: Construction of recombinant PET28a-CYP101 vector
[0091] 1. Template: extract Pseudomonas putida (Pseudomonas putida, preservation number is 700412 TM ) whole genome, used as a template for PCR amplification reactions.
[0092] 2. PCR amplification: using the whole genome of Pseudomonas putida as a template, the amplification product is obtained through PCR amplification reaction;
[0093] Among them, the designed upstream and downstream primer sequences are respectively:
[0094] Upstream primer F: CCGCCATGGCGATGGTTCCCAGCGACCTGTATC
[0095] Downstream primer R: GCGGCGGCCGCCTCGCTGTCAAACTTAATAGPCR
[0096] 3. Digestion: Digest the amplified product (the gene fragment obtained in step 2) and the prokaryotic expression vector pET28a with NcoI (NEB#R0193) and XhoI (NEB#R0146) at the same time, and recover the gene PCR product and pET-28a respectively Carrier digested fragments.
[0097] 4. The target gene fragment was ligated with the vector: T4 DNA ligas...
Embodiment 2
[0102] Example 2: Production of CYP101 strains grown in common medium
[0103] 1. Bacterial transformation: Transform 2 μl of the recombinant plasmid PET28a-CYP101 into Escherichia coli BL21-plysS competent bacteria, and streak it on the Khanna antibiotic LB solid medium plate, and place it in a constant temperature incubator at 37°C for 12-16 hours.
[0104] 2. Seed culture: Pick a single clone colony and place it in a test tube of 5 ml LB liquid medium for shaking culture at 37° C., and shake it at 250 rpm overnight.
Embodiment 3
[0105] Example 3: The bacterial strain producing CYP101 gradually adapts to the growth process in the deuterated medium
[0106] 1 Plate culture: Dilute the above-mentioned activated overnight bacteria by 1000 times, take an appropriate amount and spread it evenly on a solid culture dish with a coating stick, in which the medium is 25% deuterated solid medium, place it in a biochemical incubator at 37°C, and observe Cultivate for more than 15 hours until relatively obvious monoclonal colonies grow.
[0107] 2. Test tube culture: Pick the colony of the above monoclonal colony and culture it in a test tube of 5 ml of 25% deuterated medium at 37° C. with shaking at 250 rpm until the culture medium is relatively turbid.
[0108] 3. Carry out plate culture with the same operation as 1, at this time, the medium is 50% deuterated solid medium.
[0109] 4. Carry out test tube culture with the operation in 2. At this time, the medium is a 50% deuterated liquid medium.
[0110] 5. Sam...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap