Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Primer probe combination and fluorescence quantitative polymerase chain reaction (PCR) kit for simultaneous detection of three types of cryptococcus

A technology of primer probe and cryptococcus, applied in biochemical equipment and methods, microorganisms, recombinant DNA technology, etc., can solve difficult problems and achieve the effect of strong detection of specific type, high sensitivity and high stability

Active Publication Date: 2018-05-22
杭州缔蓝生物技术有限公司
View PDF11 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the wide variety of Cryptococcus, the nucleic acid sequence homology between species and species (with other genera such as Candida, Aspergillus, etc.) is relatively high. At the same time, the probability of variation in the entire fungal genome is much greater than that of humans Genome, so that there are not many gene sequences that can be selected as target gene sequences for species detection. Therefore, for the design of fluorescent PCR primers for the specific detection of common cryptococci such as Cryptococcus neoformans, Cryptococcus gattii, and Cryptococcus lorenti and probes are more difficult

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Primer probe combination and fluorescence quantitative polymerase chain reaction (PCR) kit for simultaneous detection of three types of cryptococcus
  • Primer probe combination and fluorescence quantitative polymerase chain reaction (PCR) kit for simultaneous detection of three types of cryptococcus
  • Primer probe combination and fluorescence quantitative polymerase chain reaction (PCR) kit for simultaneous detection of three types of cryptococcus

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Composition of the kit

[0069] 1. Primer design

[0070] According to the genomic DNA sequence of the ribosomal RNA of Cryptococcus neoformans, Cryptococcus gattii, and Cryptococcus lorentii, screen the target sequences and nucleotides of the target sequences that can universally detect these three cryptococci and are not homologous to other species The sequence is as follows:

[0071] (1) Cryptococcus neoformans target sequence (73bp):

[0072] AATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGT.

[0073] (2) Cryptococcus gattii target sequence (73bp):

[0074] AATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCAACTTGCGCCCTTTGGT.

[0075] (3) Cryptococcus Laurentii target sequence (73bp):

[0076] AATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACCTTGCGCCTTTTGGT.

[0077] Aiming at the target sequences of Cryptococcus neoformans, Cryptococcus gattii and Cryptococcus laurentii, specific primers for the detection of these three c...

Embodiment 2

[0125] Detection method of the kit

[0126] Before using this kit for detection, it is necessary to extract the DNA of the sample to be tested. The sample to be tested can be cerebrospinal fluid, alveolar lavage fluid, sputum, secretions and other samples that may contain cryptococcus. The sample DNA can be extracted by conventional methods .

[0127] 1. Preparation of PCR reaction tubes (reagent preparation area)

[0128] (1) Determine the number of reaction tubes n (number of samples + negative control + positive control); take out sterilized purified water (prepared by the user) and PCR reaction solution; take out other components in the kit, put them on ice or Thaw at room temperature. All kit components require brief centrifugation before use. Each reaction system is shown in Table 2:

[0129] Table 2, composition of reaction system

[0130] PCR reaction solution

Primer

probe

Sterilized purified water

Sample / Control

total capacity

...

Embodiment 3

[0153] Performance evaluation of the kit

[0154] 1. Detection limit

[0155] 1) The dose-effect curve of this kit and the positive reference substance of Cryptococcus neoformans

[0156]Cryptococcus neoformans positive reference substance: different concentrations of Cryptococcus neoformans cloning plasmid AXc-T.

[0157] Using the kit of Example 1 of the present invention, according to the method of Example 2, the positive reference substance of Cryptococcus neoformans was detected.

[0158] Table 5. Detection limits of Cryptococcus neoformans

[0159]

[0160] The results are shown in Table 5, and the kit can be detected within the range of 1ng / μl-0.00001ng / μl.

[0161] 2) The dose-effect curve of this kit and the positive reference substance of Cryptococcus gattii

[0162] Cryptococcus gattii positive reference substance: different concentrations of cryptococcus gattii cloning plasmid AGc-T.

[0163] Using the kit of Example 1 of the present invention, according to...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
PCR efficiencyaaaaaaaaaa
Login to View More

Abstract

The invention relates to a primer probe combination and a fluorescence quantitative polymerase chain reaction (PCR) kit for simultaneous detection of three types of cryptococcus, belonging to the technical field of in-vitro molecular detection of pathogenic microorganisms. The invention provides the primer probe combination for simultaneous detection of the three types of cryptococcus based on a fluorescence PCR method. The three types of cryptococcus comprise cryptococcus neoformans, cryptococcus gattii and cryptococcus laurentii; primers comprise an upstream primer and a downstream primer, wherein the nucleotide sequence of the upstream primer is shown in SEQ ID No.1, and the nucleotide sequence of the downstream primer is shown in SEQ ID No.2; a probe is a substance which is modified with a fluorophore at the 5'end and is modified with a fluorescence quenching group at the 3'end in a sequence shown in the SEQ ID No.3. The primer probe combination provided by the invention can realize the simultaneous detection of the cryptococcus neoformans, the cryptococcus gattii and the cryptococcus laurentii, and is high in detection specificity and high in sensitivity.

Description

technical field [0001] The invention relates to the technical field of in vitro molecular detection of pathogenic microorganisms, in particular to a primer-probe combination and a fluorescent quantitative PCR kit for simultaneously detecting three cryptococci. Background technique [0002] Deep mycoses refer to diseases caused by pathogenic fungi not only invading the skin and mucous membranes but also invading deep tissues and internal organs. Fungi are widely distributed in nature, and some fungi can infect the human body and cause disease. Deep mycoses are often secondary infections, often occurring on the basis of diabetes, blood diseases, malignant tumors, extensive burns, severe malnutrition, or other chronic wasting diseases. Or long-term application of antibiotics, glucocorticoids, immunosuppressants, imbalance of flora in the body or suppression of the body's immune response can be induced. [0003] Cryptococcosis is a potentially fatal fungal disease that often c...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12Q1/6895C12Q1/686C12Q1/04C12N15/11C12R1/645
CPCC12Q1/686C12Q1/6895C12Q2563/107C12Q2545/114C12Q2537/143
Inventor 方园吕火烊欧阳云
Owner 杭州缔蓝生物技术有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com