Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

High-temperature-resistant compound enzyme and applications thereof

A high-temperature-resistant compound enzyme and enzymatic hydrolysis technology, applied in the directions of enzymes, hydrolases, glycosylases, etc., can solve the problems of not considering β-xylosidase, low conversion substrate concentration, large enzyme dosage, etc., and achieve good results. The effect of temperature stability, fast conversion efficiency, and improved conversion recovery rate

Active Publication Date: 2018-08-10
NANJING FORESTRY UNIV
View PDF7 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The Chinese invention with application number 201710319796.0 uses cellulase and β-glucosidase to convert astragaloside IV in two-step enzymatic hydrolysis. Since the enzymatic hydrolysis temperature and pH of the two enzymes are different, the reaction conditions need to be adjusted step by step, and there is no consideration Using β-xylosidase that specifically cuts off xyloside in the substrate, at the same time, the entire reaction process uses a large amount of enzyme, takes a long time, and the concentration of the converted substrate is low, which brings difficulties to the later purification

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • High-temperature-resistant compound enzyme and applications thereof
  • High-temperature-resistant compound enzyme and applications thereof
  • High-temperature-resistant compound enzyme and applications thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Embodiment 1 The screening of β-glucosidase of the present invention

[0038] 1.1 Cloning of β-glucosidase gene derived from Dictyoglomus thermophilum DSM 3960, plasmid construction and preparation of recombinant enzyme

[0039] 1.1.1 Construction of recombinant plasmid pET-28a-Dth3

[0040] The Dictyoglomus thermophilum DSM 3960 genome was purchased from the German Culture Collection of Microorganisms. Design upstream and downstream primers according to the β-glucosidase gene in the Dictyoglomus thermophilum DSM 3960 genome (Genbank: CP001146.1):

[0041] P1: CTA GCTAGC ATGAAACTCGAGTATAAAATTCC (SEQ ID NO: 11)

[0042] P2: ATTT GCGGCCGC GCTATTTATTTCTTTTAATAGGTTTTCT (SEQ ID NO: 12)

[0043] The underline indicates the enzyme cutting site. Using Dictyoglomus thermophilum DSM 3960 genomic DNA as a template, PCR amplification was performed with synthetic primers, and the PCR product was purified by a gel recovery kit to obtain the Dictyoglomus thermophilum β-glucosi...

Embodiment 2

[0075] Embodiment 2 Screening of β-xylosidase of the present invention

[0076] 2.1 Cloning of β-xylosidase gene derived from Dictyoglomus thermophilum DSM3960, plasmid construction and recombinant enzyme preparation

[0077] 2.1.1 Construction of recombinant plasmid pET-20b-Xln-DT

[0078] The Dictyoglomus thermophilum DSM 3960 genome was purchased from the German Culture Collection of Microorganisms. Design upstream and downstream primers according to the β-xylosidase gene of the GH39 family in the Dictyoglomus thermophilum DSM 3960 genome:

[0079] P9:CGC GGATCC ATGAACCATATAAAGATTGAAA (SEQ ID NO: 19)

[0080] P10:CCG CTCGAG ATATCCACCTGGTATTTTGCTATC (SEQ ID NO: 20)

[0081] The underline indicates the enzyme cutting site, and the Dictyoglomus thermophilum DSM 3960 genome was used as a template, and the synthetic primers were used for PCR amplification, and the PCR product was purified by a gel recovery kit to obtain the Dictyoglomus thermophilum DSM 3960 β-xylosidase ...

Embodiment 3

[0141] Example 3 β-glucosidase and β-xylosidase enzyme activity assay

[0142] Using p-nitrophenol-β-glucoside (pNP-G) as a substrate, the hydrolyzed p-nitrophenol had a color reaction with sodium carbonate, and the absorbance of the product was measured at a wavelength of 405nm. The 200μL reaction system includes 180μL 50mM optimal pH buffer, 10μL 20mM substrate, mix well and preheat, add 10μL diluted enzyme solution, react at the optimal temperature for 10min, and then add 600μL 1M NaCO 3 Terminate the reaction, mix well and measure with a microplate reader under the condition of 405nm. At the same time, a control with enzyme solution without substrate and a control with substrate without enzyme solution were made.

[0143] Using p-nitrophenol-β-xyloside (pNP-X) as a substrate, the hydrolyzed p-nitrophenol had a color reaction with sodium carbonate, and the absorbance of the product was measured at a wavelength of 405nm. The 200μL reaction system includes 180μL 50mM optima...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a high-temperature-resistant compound enzyme and applications of the high-temperature-resistant compound enzyme. The high-temperature-resistant compound enzyme is composed of beta-glucosidase and beta-xylosidase. The compound enzyme provided by the invention is strong in specificity, and can completely convert astragaloside, so that the conversion recovery rate of cycloastragenol is improved. The whole process is completed within 3h, the preparation process of cycloastragenol is greatly shortened, and the production efficiency is improved; in the reaction process, the reagents including strong reducing agents, oxidizing agents, strong acid and the like do not need to be added, so that the environmental pollution is reduced; self-making of the two enzymes can be realized, thus the production cost is greatly reduced, and the process is suitable for industrial production.

Description

technical field [0001] The invention relates to the technical fields of enzyme engineering and biomedicine, in particular to a high-temperature resistant compound enzyme and its application. Background technique [0002] Astragalus membranaceus is a traditional Chinese medicine that has the effect of invigorating qi and replenishing qi blindly. It is the dried root of Astragalus membranaceus and Astragalus mongolica. Astragalus contains astragalus polysaccharides, astragalus saponins, and astragalus flavonoids, which play important roles in enhancing the body's immunity, regulating blood pressure, protecting the liver, anti-tumor, and anti-aging. At present, there are more than 40 kinds of triterpenoid saponins isolated from Astragalus membranaceus, and astragaloside IV is the most abundant. Cycloastragenol is the aglycone part of astragaloside IV, and it is the main hydrolysis metabolite of astragaloside IV in the intestine. In addition, cycloastragenol is the only compou...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/42C12P33/20
CPCC12N9/2434C12N9/2445C12P33/20C12Y302/01021C12Y302/01037
Inventor 赵林果李琦裴建军王佳宏苏二正吴涛
Owner NANJING FORESTRY UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com