Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Ralstonia solanacearum N477 extracelluar protein PHD as well as coding gene and application thereof

An extracellular protein and coding gene technology, which is applied to the extracellular protein PHD of Ralstonia solanacearum N477 and its coding gene and application fields, and can solve problems such as economic losses and destructive disasters.

Active Publication Date: 2018-09-07
NANJING AGRICULTURAL UNIVERSITY
View PDF23 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, the area of ​​protected land in northern my country has expanded significantly, and the production of vegetables in plastic greenhouses has expanded in the south. Therefore, bacterial wilt has occurred and developed in some areas, and even became a devastating disaster, causing extremely serious economic losses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Ralstonia solanacearum N477 extracelluar protein PHD as well as coding gene and application thereof
  • Ralstonia solanacearum N477 extracelluar protein PHD as well as coding gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] (1) Cloning of PopW gene sequence

[0032] Ralstonia solanacearum N477 was cultured in YGPA medium (0.5% peptone, 0.5% yeast extract powder, 1% glucose and 1.5% agar) at 30°C, and the genomic DNA was extracted after the strain grew to the logarithmic phase ( Axyprep Bacterial Genomic DNA kit, Hangzhou). Amplification primers were designed according to the whole genome sequence of the model bacteria Ralstonia solanacearum GMI1000:

[0033] Upstream primer F1: ATGTCCATCCAGATTGATCGC (SEQ ID NO.4)

[0034] Downstream primer R1: GCCCGAGTAGGCCTTGTAG (SEQ ID NO.5)

[0035] Using N477 genomic DNA as a template, perform PCR amplification. The PCR program is as follows: 94°C for 4 minutes, 94°C for 30 seconds, 60°C for 1 minute, 72°C for 1 minute, after 30 cycles, 72°C for 10 minutes, with 1% The 1143bp PCR amplified product was detected by agarose electrophoresis, and recovered according to the Agarose Gel DNA Purification Kit (TaKaRa, Dalian) manual. Connect 4 μl of the rec...

Embodiment 2

[0052] The PopW soluble protein and PHD protein obtained above were sprayed on tobacco leaves by spray method, and sterilized water without PHD protein and empty vector were used as control treatments. Two days later, the leaves sprayed with PHD and the two leaves above and below were inoculated with tobacco mosaic virus by rubbing inoculation, each treatment was repeated 3 times, and 12 tobacco seedlings were repeated each time. After 4 days, we observed the number of lesions, and calculated the control effect by the number of lesions. Control effect = [(the number of dead spots on the control leaves-the number of dead spots on the treated leaves) / the number of dead spots on the control leaves] x 100%. The results show that compared with the blank control without treatment, the number of lesions on the leaves treated by PopW soluble protein and PHD is significantly reduced, and the control effect can reach 45% and 56.88% respectively (Table 1), indicating that PopW protein an...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses ralstonia solanacearum N477 extracelluar protein PHD as well as a coding gene thereof and application thereof. An amino acid sequence of the ralstonia solanacearum N477 extracelluar protein PHD is as shown in SEQ ID NO. 1, and a coding gene nucleotide sequence is as shown in SEQ ID NO. 2. The invention further discloses application of PHD or the coding gene thereof to preparation of a biological-source pesticide for resisting bacterial wilt. A primer is designed, genome DNA is taken as a template, a PHD coding region sequence is amplified, a product is connected to a protein expression vector pET30a(+), and is converted into escherichia coli BL21(DE3) for performing protein expression, and PHD protein is purified by a nickel column. According to greenhouse test results, the protein further can induce infection of tobacco mosaic viruses, and the prevention and control effect is 56.88%.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and relates to Ralstonia solanacearum N477 extracellular protein PHD (PopW Harpin domain) and its coding gene and application. Background technique [0002] The hrp gene cluster of most Gram-negative bacteria can cause allergic reactions in non-host plants and show pathogenicity in host plants. The product of hrp gene plays a regulatory role in its expression and secretion. Harpin proteins such as HrpN of Erwinia amylovora, HrpZ of Pseudomona syringae and PopA of Ralstonia solanacearum have been identified. They can be secreted to the outside of the cell through the three-type secretion system to cause allergic reactions in non-host plants. Glycine, serine, a protein that lacks cysteine ​​and is heat-resistant, has no similarity in amino acid sequence. [0003] Bacterial wilt is a devastating soil-borne disease, and it is one of the most harmful, widely distributed, and most costly plant dise...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/70C12N1/21C12N15/31C12P21/02C07K14/195A01N47/44A01P1/00C12R1/19
CPCA01N47/44C12N15/70C07K14/195
Inventor 刘红霞陈瑜赵杨扬
Owner NANJING AGRICULTURAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com