Unlock instant, AI-driven research and patent intelligence for your innovation.

Streptomyces hygroscopicus capable of producing salicylic acid and rapamycin and application of streptomyces hygroscopicus to prevention and control of plant oomycetes and fungal diseases

A technology for plant fungal diseases and Streptomyces hygroscopicus, applied in botany equipment and methods, applications, plant growth regulators, etc., to achieve the effects of reducing economic losses, maintaining the balance and sustainable development of the ecosystem, and mitigating environmental pollution

Inactive Publication Date: 2018-10-19
CHONGQING UNIV
View PDF1 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

There are no relevant reports on the application of Streptomyces hygroscopicus as a biocontrol bacterium in agriculture to prevent and treat potato diseases

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Streptomyces hygroscopicus capable of producing salicylic acid and rapamycin and application of streptomyces hygroscopicus to prevention and control of plant oomycetes and fungal diseases
  • Streptomyces hygroscopicus capable of producing salicylic acid and rapamycin and application of streptomyces hygroscopicus to prevention and control of plant oomycetes and fungal diseases
  • Streptomyces hygroscopicus capable of producing salicylic acid and rapamycin and application of streptomyces hygroscopicus to prevention and control of plant oomycetes and fungal diseases

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 Streptomyces hygroscopicus strain identification analysis

[0033] 1. Isolation of Streptomyces hygroscopicus from soil: take the soil planted with potatoes as a sample, and separate various microorganisms by the dilution coating plate method. After counting the colonies, single colonies were obtained by observing the colony morphology and picking actinomycetes for multiple streak isolation and purification.

[0034] 2. Identification of Streptomyces hygroscopicus

[0035] The Streptomyces hygroscopicus sample that is isolated from the soil preserved in the laboratory is named as sample 1, the bacterial genome DNA of sample 1 is extracted, and PCR amplification is carried out after the electrophoresis detection is correct. The amplification primer and its sequence are: primer 1: GGTGTGTACAAGGCCCGGGAAC( SEQ ID NO: 1); Primer 2: GTGGGCAATCTGCCCTGCACT (SEQ ID NO: 2). Then electrophoresis detection, sent for sequencing, analysis of the resulting sequence spli...

Embodiment 2

[0044] Embodiment 2 Streptomyces hygroscopicus fermented liquid product analysis

[0045] Inoculate the activated Streptomyces hygroscopicus cqush011 of Example 1 into 200mL ISP liquid medium, place it at 26°C, and after 10 days of fermentation on a shaker at 200r / min, add 100ml of ethyl acetate, ultrasonically extract for 15 minutes, and take the supernatant , repeat 3 times. The supernatants were mixed three times, concentrated and dried by rotary evaporation, dissolved in methanol, filtered through a 0.22 μm filter membrane and loaded for high performance liquid phase analysis. Analysis results such as image 3 As shown, there is an absorption peak close to rapamycin and salicylic acid in the analysis results of Streptomyces hygroscopicus, that is, it contains salicylic acid and rapamycin.

Embodiment 3

[0046] Bacteriostatic test of embodiment 3 Streptomyces hygroscopicus cqush011 to plant pathogenic bacteria

[0047] (1) Configure culture medium

[0048] ISP medium preparation: glucose 4g, yeast extract powder 4g, malt extract powder, agar 20g. Weigh according to the formula, add water to make up to 1L, sterilize under high pressure at 121°C for 15 minutes. Note: Liquid medium does not add agar.

[0049] Rye (RSA) medium preparation: rye flour 60g, sucrose 20g, agar 12g. Weigh 60g rye flour, add 500mL sterile water and soak for 36 hours (or 48 hours). Filtrate to obtain filtrate 1, save it for later use, filter the filter residue in a water bath at 55°C for 3 hours to obtain filtrate 2 Mix filtrate 1 and filtrate 2, sterilize at 121°C for 10 minutes and filter to obtain filtrate 3, add 20g sucrose and 12g agar to filtrate 3 Dissolve and mix well, dilute to 1L with sterile water (if making a liquid medium, do not add agar) sterilize at 121°C for 20 minutes, cool to 50-60°...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses streptomyces hygroscopicus capable of producing salicylic acid and rapamycin and application of the streptomyces hygroscopicus to prevention and control of plant oomycetes andfungal diseases. The invention also discloses the streptomyces hygroscopicus capable of producing the salicylic acid and the rapamycin, which has the preservation number of CGMCC (China General Microbiological Culture Collection Center) No. 15518, and the application of the streptomyces hygroscopicus to the prevention and control of the plant oomycetes and fungal diseases. The invention identifiesa biocontrol bacterium aiming at the plant oomycetes and fungal diseases, especially phytophthora infestans and fusarium oxysporum; the bacterium can be used for remarkably inhibiting spore germination and mycelium growth of the phytophthora infestans; an effective method is provided for biologically preventing and controlling the plant oomycetes and fungal diseases, especially the phytophthora infestans and fusarium wilt. The method disclosed by the invention can be used for effectively preventing and controlling the phytophthora infestans, the fusarium wilt and other plant diseases and reducing the economic loss; the method has important meaning of reducing the utilization of pesticide and alleviating environment pollution, and also has significant application value of keeping the balance and sustainable development of an ecological system.

Description

technical field [0001] The invention relates to a microorganism and its application, in particular to a Streptomyces hygroscopicus producing salicylic acid and rapamycin and its application in preventing and treating plant oomycetes and fungal diseases. Background technique [0002] During the growth and development of plants, they will be harmed by various oomycetes and fungal pathogens. Potatoes originated in the Andes Mountains of South America and belong to the dicotyledonous plants of the family Solanaceae. Potatoes are also the fourth largest food crop in the world, after wheat, rice and corn. Potato late blight, caused by the oomycete pathogen Phytophthora infestans, is one of the most devastating diseases in potato production. Phytophthora infestans has colorless and non-septal hyphae, and the cyst peduncles produced by the mycelia are symaxial branches, and the top of the cyst stalks expands to produce sporangia, which are oval, round, etc. The onset of Phytophth...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N1/20A01N63/00A01P3/00C12R1/55
CPCA01N63/00C12N1/205C12R2001/55
Inventor 任茂智冯顺金良罗秀媚汤世才弗朗索瓦·塞黑尼尔车兴壁
Owner CHONGQING UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More