Streptomyces hygroscopicus capable of producing salicylic acid and rapamycin and application of streptomyces hygroscopicus to prevention and control of plant oomycetes and fungal diseases
A technology for plant fungal diseases and Streptomyces hygroscopicus, applied in botany equipment and methods, applications, plant growth regulators, etc., to achieve the effects of reducing economic losses, maintaining the balance and sustainable development of the ecosystem, and mitigating environmental pollution
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0032] Embodiment 1 Streptomyces hygroscopicus strain identification analysis
[0033] 1. Isolation of Streptomyces hygroscopicus from soil: take the soil planted with potatoes as a sample, and separate various microorganisms by the dilution coating plate method. After counting the colonies, single colonies were obtained by observing the colony morphology and picking actinomycetes for multiple streak isolation and purification.
[0034] 2. Identification of Streptomyces hygroscopicus
[0035] The Streptomyces hygroscopicus sample that is isolated from the soil preserved in the laboratory is named as sample 1, the bacterial genome DNA of sample 1 is extracted, and PCR amplification is carried out after the electrophoresis detection is correct. The amplification primer and its sequence are: primer 1: GGTGTGTACAAGGCCCGGGAAC( SEQ ID NO: 1); Primer 2: GTGGGCAATCTGCCCTGCACT (SEQ ID NO: 2). Then electrophoresis detection, sent for sequencing, analysis of the resulting sequence spli...
Embodiment 2
[0044] Embodiment 2 Streptomyces hygroscopicus fermented liquid product analysis
[0045] Inoculate the activated Streptomyces hygroscopicus cqush011 of Example 1 into 200mL ISP liquid medium, place it at 26°C, and after 10 days of fermentation on a shaker at 200r / min, add 100ml of ethyl acetate, ultrasonically extract for 15 minutes, and take the supernatant , repeat 3 times. The supernatants were mixed three times, concentrated and dried by rotary evaporation, dissolved in methanol, filtered through a 0.22 μm filter membrane and loaded for high performance liquid phase analysis. Analysis results such as image 3 As shown, there is an absorption peak close to rapamycin and salicylic acid in the analysis results of Streptomyces hygroscopicus, that is, it contains salicylic acid and rapamycin.
Embodiment 3
[0046] Bacteriostatic test of embodiment 3 Streptomyces hygroscopicus cqush011 to plant pathogenic bacteria
[0047] (1) Configure culture medium
[0048] ISP medium preparation: glucose 4g, yeast extract powder 4g, malt extract powder, agar 20g. Weigh according to the formula, add water to make up to 1L, sterilize under high pressure at 121°C for 15 minutes. Note: Liquid medium does not add agar.
[0049] Rye (RSA) medium preparation: rye flour 60g, sucrose 20g, agar 12g. Weigh 60g rye flour, add 500mL sterile water and soak for 36 hours (or 48 hours). Filtrate to obtain filtrate 1, save it for later use, filter the filter residue in a water bath at 55°C for 3 hours to obtain filtrate 2 Mix filtrate 1 and filtrate 2, sterilize at 121°C for 10 minutes and filter to obtain filtrate 3, add 20g sucrose and 12g agar to filtrate 3 Dissolve and mix well, dilute to 1L with sterile water (if making a liquid medium, do not add agar) sterilize at 121°C for 20 minutes, cool to 50-60°...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


