Transaminase derived from actinomyces, mutant, recombinant bacteria and application

A transaminase and mutant technology, which is applied to the transaminase, mutant, recombinant bacteria and application fields derived from actinomycetes, can solve the problems of poor selectivity, unsuitable for large-scale industrial production of column chromatography method, high price, etc. The effect of improved conversion rate, excellent catalytic activity, and low industrial cost

Active Publication Date: 2018-11-16
ZHEJIANG UNIV OF TECH
View PDF5 Cites 17 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The disadvantage of this method is that (R)-alanine with high chiral purity is difficult to obtain, and the use of diazomethane is dangerous.
3. The reaction between crotonate and (R)-(+)-α-phenylethylamine generates a group of epimers with two chiral centers, which are separated by silica gel column chromatography to obtain a single isomer, Then, R-3-aminobutanol is obtained through ester reduction and debenzylation; this route has fewer steps and the raw materials are easy to get, but there are still the following problems: due to the poor selectivity of the first step reaction, almost equal amounts of two Epimers are difficult to separa

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Transaminase derived from actinomyces, mutant, recombinant bacteria and application
  • Transaminase derived from actinomyces, mutant, recombinant bacteria and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0028] Example 1 Construction of transaminase-containing genetically engineered bacteria

[0029] The transaminase gene (nucleotide sequence shown in SEQ ID NO.1, amino acid sequence shown in SEQ ID NO.2) derived from actinomycete (Actinobacteriasp) was selected for whole gene synthesis, connected with plasmid pET-28b, and transferred into Escherichia coli DH5α competent cells were spread on LB plates containing kanamycin (50 μg / ml), cultured overnight at 37°C, and positive transformants were picked and identified and sequenced. Inoculate the verified positive single clone into 5 mL of LB liquid medium containing 50 μg / mL kanamycin, culture overnight at 37°C, extract the plasmid, and after re-verification, transfer the recombinant expression vector into Escherichia coli BL21(DE3) Among the strains, the recombinant strain E.coli BL21(DE3) / pET28b-TA0 (ie, the parent strain) was obtained, and cultured overnight at 37° C. on an LB plate containing kanamycin (50 μg / ml). Pick a sin...

Embodiment 2

[0030] Example 2 Obtaining of transaminase mutants and construction of genetically engineered bacteria containing mutants

[0031] 1. Construction of mutant library

[0032] Using the recombinant expression vector pET28b-TA0 obtained in Example 1 as a template, the mutant sequence was obtained by error-prone PCR amplification. Amplification primers are (5'GCTGA GGATCC ATGACCATCTCTAAAGACAT3') and (5'GCATC AAGCTT TCAGTATTCGATAGCTTC3').

[0033] Amplification system: 50μl Reaction system: 10xTaq polymerase buffer: 5μl; Mg 2+ (25mM): 2-8μl; Mm 2+ (25mM): 2-8μl; 10mM dNTP mixture (dATP, dCTP, dGTP and dTTP each 2.5mM) 4μL; concentration of 50μM upstream primer, downstream primer 1μL each, DNA template: 1μL; Taq DNA polymerase: 10U; Top up the system with steamed water.

[0034] The PCR reaction conditions were as follows: pre-denaturation at 95°C for 1min, followed by a temperature cycle of 95°C for 10s, 56°C for 90s, and 72°C for 1min, a total of 30 cycles, and finally an ...

Embodiment 3

[0038] Embodiment 3 Preparation of transaminase wild-type and mutant catalysts

[0039] 1) Slant culture: Inoculate recombinant bacteria E.coliBL21(DE3) / pET28b-TA0 and recombinant bacteria E.coliBL21(DE3) / pET28b-TA1 containing transaminase wild-type gene and transaminase mutant gene into card containing 50 μg / ml respectively. The LB medium of namycin was cultured at 37°C for 16h to obtain slant bacteria; the mass final concentration of the LB medium consisted of: peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, 1.5 % agar, the solvent is deionized water, pH 7.0, and 50 μg / ml kanamycin is added before use.

[0040] 2) Seed culture: inoculate the slant bacteria into LB liquid medium containing 50 μg / ml kanamycin, cultivate at 37°C for 8-10 hours, and obtain seed liquid; the final concentration of the LB liquid medium is composed of: peptone 10g / L, yeast extract 5g / L, sodium chloride 10g / L, solvent is deionized water, pH 7.0, add 50μg / ml kanamycin before use.

[0041]...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses transaminase derived from actinomyces, a mutant, recombinant bacteria and application. A biological preparation method of R-3-aminobutanol, provided by the invention, takes butanone alcohol as a raw material the price is cheap. A large amount of needed recombinant transaminase can be prepared through constructing escherichia coli genetic engineering bacteria and then fermenting, and is relatively easy to obtain and cheap. Reaction is one-pot-boiling type reaction; after a substrate and an enzyme are added, the reaction is started and a final product R-3-aminobutanol isdirectly obtained; the industrial cost is low. Compared with a wild type, an actinomyces transaminase mutant provided by the invention has better catalytic activity. Under an optimal system, the conversion rate on the 100mM substrate reach 90 percent and the ee value reaches 99.9 percent; the conversion rate on the 500mM substrate reach 78 percent and the ee value reaches 99.9 percent; compared with the wild type, the actinomyces transaminase mutant has the advantage that the conversion rates on the substrates are respectively improved by 12 percent to 25 percent.

Description

(1) Technical field [0001] The invention relates to a transaminase gene derived from Actinobacteria, a mutant, an engineering bacterium and the application thereof in catalytically synthesizing R-3-aminobutanol. (2) Background technology [0002] The structural formula of R-3-aminobutanol is as follows, and it is widely used in organic synthesis and pharmaceutical production. [0003] [0004] R-3-aminobutanol is an important raw material for the synthesis of dolutegravir, an anti-AIDS integrase inhibitor approved by the US FDA in 2013, and the existing HIV integrase inhibitor Raltegravir Compared with Raltegravir, an anti-HIV / AIDS drug of Merck & Co., Dolutegravir not only achieved comparable efficacy in phase III clinical trials, but also It does not need to be combined with drug accelerators, and has very strong drug resistance properties. The quality and price of the intermediate R-3-aminobutanol have a very important impact on the quality and production cost of dol...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N9/10C12N15/54C12N15/70C12N1/21C12P13/00C12R1/19
CPCC12N9/1096C12P13/001
Inventor 汤晓玲郑裕国郑仁朝张南南
Owner ZHEJIANG UNIV OF TECH
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap