Polypeptides having cellulolytic degradation enhancing activity and application thereof

A technology for enhancing activity and cellulose decomposition, applied in the direction of microorganism-based methods, using vectors to introduce foreign genetic material, biochemical equipment and methods, etc., can solve the problem of low activity and achieve the effect of improving utilization efficiency and improving saccharification efficiency

Active Publication Date: 2019-04-02
SHANDONG HENGLU BIOTECH CO LTD
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although cellulase is commonly used to produce microorganisms - Trichoderma reesei when producing enzyme liquid, the enzyme liquid also has LPMO activity, but the activity is not high

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Polypeptides having cellulolytic degradation enhancing activity and application thereof
  • Polypeptides having cellulolytic degradation enhancing activity and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0082] Acquisition of Trichoderma reesei Genome

[0083] (1) Trichoderma reesei was cultured on the bran medium for three days, and then the spores were eluted with physiological saline, according to 1×10 8 Proportionally inserted into the basic medium, 200rpm, 30°C for two days, centrifuged at 4000rpm, collected bacteria, collected in a 1.5ml centrifuge tube;

[0084] (2) Add 500 μl of extraction buffer and 0.1 g of quartz sand to the centrifuge tube, vortex vigorously for 1 min to disperse the bacteria in the extraction buffer, place at 65°C for 20 min; add 500 μl of phenol / chloroform (mixing volume ratio 1:1), vortex vigorously for 30s, centrifuge at 12000rpm for 10min at room temperature, and collect the supernatant;

[0085] (3) Transfer the supernatant to another sterile 1.5ml centrifuge tube, add 0.1 times the volume of 3M NaAc solution (pH4.8) and 0.6 times the volume of isopropanol, mix it upside down, and place it at -20°C for 15 minutes ;12000rpm, 4°C, 10min, disc...

Embodiment 2

[0087] Expression and Purification of Mature Polypeptide LPMO-N in Escherichia coli

[0088] (1) Codon optimization is performed on the mature polypeptide of SEQ ID NO.1 to obtain SEQ ID NO.2, and then gene synthesis is performed. Primers were selected, and the target gene was amplified with KOD FX DNA polymerase from TOYOBO Company. After agarose gel electrophoresis to verify the correct size of the band, the band was cut out, and the gene fragment was recovered with an OMEGA gel extraction kit.

[0089] E. coli-LPMO-N-F:

[0090] GGCCAGTCGAACCACGCAATGCGTCTCGATCCGCAGTGTCTTGCGTCTCTATGCCGAGCACCAAAGTGGCAGCGT, as shown in SEQ ID NO.4;

[0091] E.coli-LPMO-N-R:

[0092] GCACACAGGAAACAGCTATGACCGTCTCGGTTGGCAGTGACTCCGTCTCTTCAGTGATGATGATGATGATGATGCAGC, as shown in SEQ ID NO.5;

[0093] PCR conditions were: 94°C for 5 min; 98°C for 10 s, 58°C for 30 s, 68°C for 1.5 min, 30 cycles; 68°C for 10 min, stored at 4°C to obtain Fragment 1.

[0094] (2) Using the pet21a plasmid of EMD Bio...

Embodiment 3

[0106] Degradation experiment of phosphoric acid swollen cellulose:

[0107] Phosphoric acid swollen cellulose (PASC) was prepared from Avicel according to published procedures (see references below).

[0108] The reaction was carried out in 100 mM ammonium formate buffer solution, pH 6.0, and the reaction system contained: 4 mM ascorbic acid, 0.5% (w / v) PASC, mixed into the purified LPMO-N in Example 2 Ecoli After 16 hours of incubating the polypeptide at 20°C, the hydrolysis reaction was terminated. Centrifuge at 3000 rpm for 5 min at room temperature. The hydrolysis reaction product in the supernatant was analyzed by MALDI-TOF / TOF MS detection analysis, the mass spectrogram is as follows figure 1 . The product contains the following substances: C-1, C-4 and C-6 oxidized oligosaccharides (oxidized oligosaccharides), aldonic acid (aldonic acid, m / z+16), C4-ketoaldose (ketoaldehyde) or C6-hexodialdose (Adipaldehyde) (m / z-2), minor double C4 and C6 oxidized oligosaccharides...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The present disclosure relates to polypeptides having cellulolytic degradation enhancing activity and application thereof, and provides application of polypeptides with an amino acid sequence shonw asa SEQ ID NO.1 in the preparation of a thermostable auxiliary active enzyme having cellulolytic degradation enhancing activity. The polypeptides can effectively degrade cellulose, and can be combinedwith other cellulose degrading enzymes to improve the saccharification efficiency of cellulose-containing raw materials; and the polypeptides can be further applied to industrial fermentation production of ethanol by using lignocellulose such as straw, thereby increasing the utilization efficiency of the lignocellulose such as straw.

Description

technical field [0001] The disclosure relates to a polypeptide having cellulose degradation enhancing activity and its application, in particular to a polypeptide having a better synergistic effect with cellulase and its application, which belongs to the technical field of bioengineering. Background technique [0002] The statements herein merely provide background information related to the present disclosure and may not necessarily constitute prior art. [0003] Cellulase is widely used in food, textile, lignocellulose biotransformation and so on. Improving the saccharification efficiency of cellulase on substrates is of great significance for reducing the cost of industrial production. [0004] Cellulase is often produced by filamentous fungi, and the methods of transforming industrial strains of filamentous fungi to improve cellulase activity include mutagenesis breeding technology, protoplast fusion technology, gene rearrangement technology, etc. [0005] However, the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/02C12N1/15C12N15/80C12P7/10C12R1/885
CPCC12N9/0004C12N15/80C12P7/10Y02E50/10
Inventor方诩吴琦侯少莉
OwnerSHANDONG HENGLU BIOTECH CO LTD