Difunctional fusion protein and method for producing D-phenyllactic acid from same

A fusion protein and fusion gene technology, which is applied in the field of engineering bacteria to catalyze the generation of D-phenyllactic acid, D-lactic dehydrogenase and glycerol dehydrogenase fusion proteins in whole cells, can solve the problems of hidden safety hazards and high investment costs, and achieve High safety, reduced production costs, and the effect of reducing production costs

Inactive Publication Date: 2019-04-16
CHONGQING UNIV
View PDF6 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, using formic acid as the raw material for coenzyme regeneration requires explosion-proof equipment in industrial production, which has the disadvantages of high investment costs and potential safety hazards.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Difunctional fusion protein and method for producing D-phenyllactic acid from same
  • Difunctional fusion protein and method for producing D-phenyllactic acid from same
  • Difunctional fusion protein and method for producing D-phenyllactic acid from same

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 2

[0085] The identification of embodiment 2 engineering bacterium expression product

[0086] (1) The engineering bacterium BL21 / pET28a-d-ldh-L obtained by implementing case 1 1 -gldh was inoculated into LB medium, cultured at 37°C to the logarithmic growth phase, added IPTG to a final concentration of 0.5mmol / L, and continued to culture for 12h. The bacteria were collected by centrifugation, ultrasonically disrupted, and the supernatant was collected by centrifugation. The purified fusion protein was purified by His-Tag affinity chromatography column, and verified by SDS-PAGE electrophoresis. A clear band was obtained at about 70KDa, which was consistent with the expected fusion protein. The size matches.

[0087] (2) Add the obtained purified protein solution into the reaction solution (2ml reaction system) to carry out the catalytic reaction. The reaction solution contains 10mM phenylpyruvate, 20mM glycerol, 1.8mL of 0.02mol / L potassium phosphate buffer solution, and reacted...

Embodiment example 3

[0088] Example 3 using BL21 / pET28a-d-ldh-L 1 -gldh whole-cell catalyzed production of D-phenyllactic acid

[0089] (1) Strains: BL21 / pET28a-d-ldh-L obtained in Example 1 1 -gldh.

[0090] (2) Insert the engineered bacteria into the seed culture medium, cultivate them in a shaker at 37°C and 200r / min for 10h, insert them into the fermentation medium (containing 40μg / mL kanamycin) according to the inoculum size of 5%, adjust The pH is between 6.0 and 7.0, placed in a shaker at 37°C, 200r / min, and shaken at a constant temperature to cultivate the cell density to OD 600 1.0, add 0.5mmol / L IPTG, and ferment at 25°C for 12h.

[0091] (3) Centrifuge at 4°C and 6000r / min for 10min, collect the bacteria, wash twice with 0.02M potassium phosphate buffer solution with pH 7.0, resuspend in 10ml containing 5% glycerol, 10g / L phenylpyruvate and 0.6% Tween 80 In the potassium phosphate buffer (pH 7.0, 0.02M) transformation system, the bacterial cell concentration OD 600 After reaching 5...

Embodiment 4

[0094] Example 4 utilizes BL21 / pET28a-d-ldh-L 2 -gldh(L 2 Representative linker: GGGGSGGGGS) Whole-cell catalytic production of D-phenyllactic acid

[0095] (1) bacterial classification: the primer P in embodiment 1 2R-1 ,P 3F-1 replace with P 2R-2 ,P 3F-2 , then the bacterial strain BL21 / pET28a-d-ldh-L obtained by the method of Example 1 2 -gldh, all the other construction methods are the same as embodiment 1;

[0096] P 2R-2 (5'-3'): TGATTGAATAATGCGGTCCATGGAGCCACCACCACCGGAGCCACCACCGCCACCAACCTTA ACTGG (SEQ ID NO.11)

[0097] P 3F-2 (5'-3'):GAAACCCCAGTTAAGGTTGGT GGCGGTGGTGGCTCCGGTGGTGGTGGCTCC ATGGACCGCATTATTCAATCACCG (GGGGSGGGGS) (SEQ ID NO. 12)

[0098] (2) Insert the engineered bacteria into the seed culture medium, cultivate them in a shaker at 30°C and 300r / min for 12h, insert them into the fermentation medium (containing 40μg / mL kanamycin) according to the inoculum size of 10%, adjust The pH is between 6.0 and 7.0, placed in a shaker at 37°C, 200r / min, and sha...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of microbial fermentation, particularly relates to D-lactic dehydrogenase and glycerol dehydrogenase fusion protein, and relates to a method for generatingD-phenyllactic acid through whole-cell catalysis of engineering bacteria containing the fusion protein. A gene fusion strategy is utilized, D-lactic dehydrogenase (D-LDH) and glycerol dehydrogenase (GlDH) are subjected to fusion expression and introduced into a D-phenyllactic acid anabolism means for the first time, and in the reaction of asymmetric synthesis of the D-phenyllactic acid (D-PLA) with phenylpyruvic acid as a substrate, regeneration of coenzyme factors and production of the high-yield D-phenyllactic acid are achieved. The cost is low, the safety is high, glycerol is converted into dihydroxy acetone, and the fusion protein can serve as an important medicine and chemical synthesis intermediate, is widely applied to fine chemical industry, food industry and cosmetic industry andis high in additional value.

Description

Technical field: [0001] The invention belongs to the technical field of microbial fermentation, and specifically relates to a fusion protein of D-lactate dehydrogenase and glycerol dehydrogenase, and also relates to a method for producing D-phenyllactic acid catalyzed by whole cells of engineering bacteria containing the fusion protein. Background technique: [0002] Phenyllactic acid (PLA, Phenyllactic acid), namely 2-hydroxy-3-phenylpropionic acid, is a natural organic acid widely found in honey and lactic acid bacteria fermentation products. Its molecular formula is C 9 h 10 o 3 , the relative molecular mass is 166, and the melting point is 121-125°C. Phenyllactic acid has a slight special smell, is easily soluble in organic solvents such as acetone, ethyl acetate, ether and methanol, slightly soluble in water, and can be evenly dissolved in water-based solvents. The solubility in water increases with the increase of temperature. The second carbon atom of phenyllactic...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N9/04C12N15/53C12N15/70C12N1/21C12P7/42C12R1/19
CPCC07K2319/00C12N9/0006C12N15/70C12P7/42C12Y101/01006C12Y101/01028
Inventor王丹陈朋吕欣怡熊小超周桢周小华
OwnerCHONGQING UNIV