Y-chromosomal microdeletion detection method and primer group
A technology of Y chromosome and primer set, which is applied in the field of molecular biology gene technology and medical field, can solve the problems such as the detection of gene sequence label sites of the IonTorrent semiconductor chip sequencing technology that has not been reported, and achieve fast detection speed, stable results and specificity and high sensitivity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0037] Example 1. Design of a primer set for detection of Y chromosome microdeletion-related gene sequence tag sites.
[0038] Using bioinformatics knowledge and related bioinformatics software, PCR primers were designed with Primer Express Software 5.0 software for the seven sequence tag sites of AZFasY84, AZFasY86, AZFasY127, AZFasY134, AZFasY254, AZFasY255, and SRYsY14 that can be retrieved from public databases , the primer sequence is:
[0039] Primers for detecting the AZFasY84 sequence tag site:
[0040] Upstream primer: 5'- acagggaacgcctgatttcaccctttacagttta -3' SEQ ID No: 1
[0041] Downstream primer: 5'- gggagtagggaggtagagccac -3' SEQ ID No: 2
[0042] Primers for detecting the AZFasY86 sequence tag site:
[0043] Upstream primer: 5'- acagggaacgggtaatggcttcccagagttg -3' SEQ ID No: 3
[0044] Downstream primer: 5'- tcaaggactgtgagaatcaaggt -3' SEQ ID No: 4
[0045] Primers for detecting the AZFasY127 sequence tag site:
[0046] Upstream primer: 5'- acagggaacgttcata...
Embodiment 2
[0061] Example 2. Detection of Y chromosome microdeletion-related genes.
[0062] 1) Acquisition of sample genomic DNA
[0063] Extract the DNA from exfoliated cells of the oral mucosa by cell lysis, suspend in 1 mL of normal saline, and centrifuge at 2000×g for 10 min; discard the supernatant, add 1 mL of normal saline to each tube for repeated washing, and then centrifuge at 2000×g for 10 min; discard the supernatant Add 400μL cell lysis buffer (10mmol / L Tris-HCl, PH8.0; 0.1mol / L Tris-HCl, PH8.0; 0.5%SDS) to each tube, incubate in a 50℃ water bath for 30min; then cool to room temperature, add Equal volume of phenol-chloroform-isoamyl alcohol (volume ratio 25:24:1), mix well, and centrifuge at 5000×g for 10 min; transfer the upper aqueous phase to another centrifuge tube, and repeat the extraction once; then transfer the upper layer of water Phase into another Eppendorf tube, add 1 / 10 volume of 3M NaAc (PH5.2), mix well; add 2.5 times volume of 95% cold ethanol, mix well, pr...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com

