Y-chromosomal microdeletion detection method and primer group

A technology of Y chromosome and primer set, which is applied in the field of molecular biology gene technology and medical field, can solve the problems such as the detection of gene sequence label sites of the IonTorrent semiconductor chip sequencing technology that has not been reported, and achieve fast detection speed, stable results and specificity and high sensitivity

Inactive Publication Date: 2019-05-24
上海联吉医学检验所有限公司
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] At present, there is no report that the Ion Torrent semiconductor chip sequencing technology...

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Y-chromosomal microdeletion detection method and primer group

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0037] Example 1. Design of a primer set for detection of Y chromosome microdeletion-related gene sequence tag sites.

[0038] Using bioinformatics knowledge and related bioinformatics software, PCR primers were designed with Primer Express Software 5.0 software for the seven sequence tag sites of AZFasY84, AZFasY86, AZFasY127, AZFasY134, AZFasY254, AZFasY255, and SRYsY14 that can be retrieved from public databases , the primer sequence is:

[0039] Primers for detecting the AZFasY84 sequence tag site:

[0040] Upstream primer: 5'- acagggaacgcctgatttcaccctttacagttta -3' SEQ ID No: 1

[0041] Downstream primer: 5'- gggagtagggaggtagagccac -3' SEQ ID No: 2

[0042] Primers for detecting the AZFasY86 sequence tag site:

[0043] Upstream primer: 5'- acagggaacgggtaatggcttcccagagttg -3' SEQ ID No: 3

[0044] Downstream primer: 5'- tcaaggactgtgagaatcaaggt -3' SEQ ID No: 4

[0045] Primers for detecting the AZFasY127 sequence tag site:

[0046] Upstream primer: 5'- acagggaacgttcata...

Embodiment 2

[0061] Example 2. Detection of Y chromosome microdeletion-related genes.

[0062] 1) Acquisition of sample genomic DNA

[0063] Extract the DNA from exfoliated cells of the oral mucosa by cell lysis, suspend in 1 mL of normal saline, and centrifuge at 2000×g for 10 min; discard the supernatant, add 1 mL of normal saline to each tube for repeated washing, and then centrifuge at 2000×g for 10 min; discard the supernatant Add 400μL cell lysis buffer (10mmol / L Tris-HCl, PH8.0; 0.1mol / L Tris-HCl, PH8.0; 0.5%SDS) to each tube, incubate in a 50℃ water bath for 30min; then cool to room temperature, add Equal volume of phenol-chloroform-isoamyl alcohol (volume ratio 25:24:1), mix well, and centrifuge at 5000×g for 10 min; transfer the upper aqueous phase to another centrifuge tube, and repeat the extraction once; then transfer the upper layer of water Phase into another Eppendorf tube, add 1 / 10 volume of 3M NaAc (PH5.2), mix well; add 2.5 times volume of 95% cold ethanol, mix well, pr...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention relates to the technical and medical fields of molecular biology genes, in particular to a Y-chromosomal microdeletion detection method and primer group. The nucleotide sequence of sevensequence tag sites of AZFasY84, AZFasY86, AZFasY127, AZFasY134, AZFasY254, AZFasY255 and SRYsY14 is analyzed, corresponding primers are designed, multiple PCR (polymerase chain reaction) amplification on specific sites of genomic DNA in the sample is performed, and finally detection is carried out with the Ion Torrent semiconductor chip sequencing technology. The detection method has the advantages of large flux, high specificity and sensitivity, stable results, good repeatability, fast detection speed and the like; a fast, reliable and accurate new approach is provided for detecting, testing, analyzing and evaluating the genetic aspects of male infertility, and theoretical basis is provided for clinical diagnosis of the diseases.

Description

technical field [0001] The invention relates to the field of molecular biology gene technology and the field of medicine, and relates to a primer set for detecting Y chromosome microdeletion-related gene sequence tag sites using molecular biology methods, and in particular to using Ion Torrent semiconductor chip sequencing technology to detect Y chromosome microdeletions Related primer sets and kits for qualitative and quantitative detection. Background technique [0002] The incidence of male infertility is very high, about one in every 20 men suffers from male infertility. The reason is mostly infertility caused by lack of sperm and less sperm. According to the WHO standard, more than two semen routine analysis can be divided into azoospermia and severe oligospermia (sperm density <5×10 6 / m1), oligospermia (sperm density <20×10 6 / m1) and asthenospermia with normal density (sperm density>20×10 6 / ml, sperm motility <50%) four categories. There are many ca...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12Q1/6883
Inventor 裘敏燕
Owner 上海联吉医学检验所有限公司
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap