Method for preparing dexketoprofen

A technology of dexketoprofen and amidoketone, which is applied in the field of bioengineering, can solve problems such as low conversion rate or optical purity, and failure to meet production requirements, and achieve the effect of improving catalytic reaction efficiency

Inactive Publication Date: 2020-07-03
HEC PHARM
View PDF2 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the conversion rate or optical purity of the prior art is low, which still cannot meet the production requirements

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for preparing dexketoprofen
  • Method for preparing dexketoprofen
  • Method for preparing dexketoprofen

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1 Construction of amidase AMD02 Escherichia coli expression strain

[0035] According to the amino acid sequence of Klebsiella amidase AMD02, the sequence is shown in SEQ ID NO:2. The gene was cloned at the NcoI and HindIII sites of pET28a, and the nucleic acid sequence was optimized according to the E. coli codons. The optimized nucleic acid sequence is shown below and was submitted to General Biosystems (Anhui) Co., Ltd. for synthesis.

[0036] ATGGCAATTCAGCGTCCGACCGCAGAACAGCTGCAGGAACTGGCAAGCCGTCTGCATATTAGCCTGACCACCGCACAGGCGGAAGAATATCTGGCTGTGATGCAGGCTAATTTTGATGCATATGATCTGATTGATAGTCTGCCGGATGATATTCCGGAAGTGCGCTATCCGCGTGCAGCAGGTTATCGTCCGACCGGCGAAGATAATCCGCTGAATGCATGGTATTATAAAACCGAAGTGAAAGGTGCAGCTACCGGTGCACTGGCTGGCCGCACCATTGCCCTGAAAGATAATGTTTCTCTGGCCGGCGTGCCGATGATGAATGGCGCCAGTACCCTGGAAGGCTTTGTTCCGAGTTGCGATGCGACCGTTGCAACCCGTCTGCTGGATGCCGGCGCCACCATTCTGGGTAAAGCGACCTGCGAACATTTTTGCCTGAGCGGTGGTTCTCATACCTCAGATCCGGCCCCGGTTCATAATCCGCATCGCCACGGTTATTCTAGCGGCGGCAGTTCATCTGGTAGTGCGGCA...

Embodiment 2

[0039] Example 2 Shake flask induced expression of amidase AMD02

[0040] Pick a single colony on the transformation plate to 5mL LB+Kan liquid medium (10g / L peptone, 5g / L yeast powder, 10g / L sodium chloride, 50μg / mL kanamycin), 37℃250rpm / min Cultivate overnight under the conditions, about 12h.

[0041] Take the activated bacteria solution overnight, transfer 500μl to fresh 50mL LB+Kan liquid medium, and incubate at 37℃250rpm / min until the OD reaches 0.5-0.8.

[0042] Take the cultured AMD02 bacterial solution, add IPTG with a final concentration of 1 mM, and culture for 5 hours at 30°C and 250 rpm / min.

[0043] After the induction, all the bacterial liquid was collected and centrifuged at 8000 prm / min and 4 degrees Celsius to collect the bacterial cells. Take appropriate bacteria to break the wall to detect protein expression.

[0044] See for protein induction figure 1 .

Embodiment 3

[0045] Example 3 50L tank fermentation of amidase AMD02

[0046] Take the overnight activated bacterial solution in Example 2, transfer 1 mL to a fresh 1000 mL LB+Kan liquid medium, incubate at 37°C for about 10 hours at 250 rpm / min, and then inoculate a 50L fermentor (fermentation medium: 121g glucose monohydrate , Yeast extract powder 500g, yeast peptone 250g, NaCl100g, Na 2 HPO 4 25g, MgSO 4 .7H 2 O 20g, KH 2 PO 4 100g, (NH 4 ) 2 SO 4 50g, 55g of citric acid monohydrate, 75g of NaOH, 25mL of GPE defoamer. Sterilize at 118°C for 30 minutes, and the volume after elimination is 25L).

[0047] Basic culture stage: control the culture temperature to 37.0℃, the aeration volume is 1:1vvm, the dissolved oxygen level of the fermentation broth is adjusted to be higher than 50% by stirring and aeration, and the tank pressure is 40-70Kpa.

[0048] Glucose supplement stage: start to add glucose solution when the pH of the fermentation broth rebounds to 7.15. The initial sugar supplement rat...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a method for preparing dexketoprofen. The method comprises deamination of ketoprofen amide catalyzed by amidase derived from Klebsiella to obtain dexketoprofen. The inventors found that the amidase derived from Klebsiella has stronger specific recognition ability to dexketoprofen, and the dexketoprofen is prepared by using the amidase derived from Klebsiella, so that the eevalue of dexketoprofen can be greatly.

Description

Technical field [0001] The present invention relates to the field of bioengineering, and specifically, the present invention relates to a method for preparing dexketoprofen. Background technique [0002] Ketoprofen is a 2-arylpropionic acid nonsteroidal anti-inflammatory drug (NSAIDs). These drugs all have a chiral center. Only the dextrorotatory isomer has anti-inflammatory, antirheumatic and analgesic effects, while the levorotatory isomer has almost no It has pharmacological activity and serious side effects. [0003] Currently, the main synthesis methods of commercially available (S)-(+)-ketoprofen include traditional chemical synthesis, chiral separation and biological enzyme synthesis. [0004] The chemical synthesis method is mainly asymmetric synthesis, which can be carried out through a 6-step reaction. (2S, 3S) epoxy compounds are prepared from allyl alcohol through sharpless epoxidation, and then a chiral shift reagent is added, and after enantioselective hydroge...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/80C12N9/88C12P7/40C12R1/19
CPCC12N9/80C12N9/88C12P7/40C12Y402/01084
Inventor林洁王小龙张慧叶燕全杨志雄胡盛本谢文平鲍素敏封海生
OwnerHEC PHARM