Phytase mutant

A mutant, acid enzyme technology, applied in the direction of enzyme, hydrolase, plant gene improvement, etc., can solve the problems of high phosphorus feces polluting the environment, waste of phosphorus source, poor thermal stability, etc.

Active Publication Date: 2020-09-08
QINGDAO VLAND BIOTECH GRP
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, phosphorus in the form of phytate phosphorus is difficult to be utilized due to the lack of enzymes that can decompose phytic acid in monogastric animals, and its utilization rate is only 0% to 40%, which causes many problems: first, it causes waste of phosphorus On the one hand, the phosphorus source in the feed cannot be effectively utilized; on the other hand, in order to meet the demand of animals for phosphorus, inorganic phosphorus must be added to the feed, which increases the cost of feed; secondly, the formation of high-phosphorus feces pollutes the environment
Bacterial phytase APPA has poor thermal stability, and the remaining enzyme activity of its aqueous solution is lower than 30% when it is incubated at 70°C for 5 minutes, and the remaining enzyme activity is generally lower than 20% after being directly added to animal feed for granulation, making APPA phytase The application of acid enzymes in pellet feed is limited
The method of spraying the phytase solution on the feed after feed granulation not only increases equipment investment, but also cannot guarantee the stability of the enzyme preparation and the uniformity of distribution in the feed.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0209] Example 1 Screening of heat-resistant mutants

[0210] The amino acid sequence of the wild-type phytase APPA derived from Escherichia coli is SEQ ID NO: 1, and its coding nucleotide sequence is SEQ ID NO: 2. In order to improve the heat resistance of phytase APPA, the applicant analyzed the protein structure of its gene. The protein has two structural domains: 134 amino acid residues at the N-terminus and 152 amino acid residues at the C-terminus together form domain 1, The remaining 124 amino acid residues in the middle constitute domain 2, and the conserved sequence and active center are located in domain 1. On the premise of not destroying the protein secondary structure and active center, the gene is further mutated.

[0211] 1.1 Design PCR primers APPA-F1, APPA-R1:

[0212] APPA-F1: GGC GAATTC CAGTCAGAACCAGAGTTGAAGTT (the underline is the restriction endonuclease EcoRI recognition site), as shown in SEQ ID NO: 3;

[0213] APPA-R1: ATA GCGGCCGC TTACAAGGAACAA...

Embodiment 2

[0240] Example 2 Expression of phytase mutants in Pichia pastoris

[0241] According to the coding preference of Pichia pastoris, the APPA gene sequence SEQ ID NO: 2 and the mutant gene sequence were optimized and synthesized, and EcoRI and NotI were added to the 5' and 3' ends of the synthetic sequence respectively. cut site.

[0242] 2.1 Construction of expression vector

[0243] The gene sequences of the synthesized APPA and the mutant were digested with EcoRI and NotI respectively, and then ligated with the pPIC-9K vector after the same digestion at 16°C overnight, and transformed into Escherichia coli DH5a, spread on the LB+Amp plate, Inverted culture at 37°C, after transformants appeared, colony PCR (reaction system: template-picked single clone, rTaqDNA polymerase 0.5ul, 10×Buffer 2.0μL, dNTPs (2.5mM) 2.0μL, 5'AOX primer (10M ): 0.5 μL, 3’AOX Primer: 0.5 μL, ddH 2 O14.5μL, reaction program: 95°C pre-denaturation for 5min, 30 cycles: 94°C 30sec, 55°C 30sec, 72°C 2min,...

Embodiment 3

[0261] Embodiment 3 Expression of phytase mutant in Trichoderma reesei

[0262] According to the codon preference of Trichoderma, the APPA gene sequence SEQ ID NO: 2 and the mutant gene sequence were optimized and synthesized, and KpnI and MluI were added to the 5' and 3' ends of the synthetic sequence respectively. Restriction sites.

[0263] 3.1 Construction of expression vector

[0264] The synthesized phytase gene fragment and pSC1G vector were digested with restriction endonucleases KpnI and MluI (Fermentas) respectively, and the digested products were purified using a gel purification kit, and separated with T4 DNA ligase (Fermentas). The above phytase gene was ligated with the digested product of pSC1G vector and transformed into Escherichia coli Trans5α (Transgen), selected with ampicillin, and the clone was verified by sequencing (Invitrogen). After the sequencing is correct, a recombinant plasmid containing the phytase gene is obtained.

[0265] 3.2 Construction o...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of biology, in particular to a phytase mutant, a preparation method and application thereof, a DNA molecule for encoding the phytase mutant, a vector and ahost cell. The mutant provided by the invention comprises substitutions of amino acids on at least one position selected from a group including 10, 31, 52, 75, 90, 99, 157, 158, and 179. The heat resistance of the mutant is remarkably improved, so that wide application of phytase in feeds is facilitated.

Description

technical field [0001] The invention relates to the field of biotechnology, in particular to a phytase mutant, its preparation method and application, a DNA molecule encoding the phytase mutant, a carrier, and a host cell. Background technique [0002] Phytase is a phosphatase that hydrolyzes phytic acid. It degrades phytate phosphorus (inositol hexaphosphate) into inositol and inorganic phosphate. This enzyme is divided into two classes: 3-phytase (EC. 3. 1. 3. 8) and 6-phytase (EC. 3. 1. 2. 6). Phytase widely exists in plants, animals and microorganisms, such as higher plants such as corn and wheat, prokaryotic microorganisms such as Bacillus subtilis, Pseudomonas, Lactobacillus, Escherichia coli, and eukaryotic microorganisms such as yeast, rhizopus, and Aspergillus . [0003] In the seeds of crops such as grains, beans and oilseeds, the basic storage form of phosphorus is phytate phosphorus, and its content is as high as 1% to 3%, which accounts for 60% to 80% of the ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/16C12N15/55C12N15/81C12N15/80C12N1/19C12N1/15C12R1/84C12R1/885
CPCC12N9/16C12N15/815C12N15/80C12Y301/03008C12Y301/02006
Inventor黄亦钧张霞程斯达康丽华李宾
OwnerQINGDAO VLAND BIOTECH GRP