Unlock instant, AI-driven research and patent intelligence for your innovation.

Expression system utilizing GPI anchor protein containing selenocysteine and cell for highly expressing recombinant protein

A selenocysteine ​​and anchored protein technology, which is applied in the field of cells using a GPI-anchored protein expression system containing selenocysteine ​​and cells with high expression of recombinant proteins, can solve hair loss, nail and skin darkening and other problems to achieve the effect of simplifying difficulty and convenient screening

Inactive Publication Date: 2020-12-04
JIANGNAN UNIV
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Long-term overdose of selenium can lead to hair loss, darkening of nails and skin, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression system utilizing GPI anchor protein containing selenocysteine and cell for highly expressing recombinant protein
  • Expression system utilizing GPI anchor protein containing selenocysteine and cell for highly expressing recombinant protein
  • Expression system utilizing GPI anchor protein containing selenocysteine and cell for highly expressing recombinant protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0033] Construction of a GPI-anchored protein expression system containing selenocysteine ​​(taking recombinant lysosomal acid lipase (LIPA) as an example) by combining the oxidoreductase protein family selenocysteine ​​and GPI Ankyrin synthesis features are constructed.

[0034] To express LIPA with GPI-anchored and soluble forms, the stop codon UGA was inserted before the GPI attachment signal sequence of pME-Puro-sHF-LIPA-GPI (sHF stands for endoplasmic reticulum signal sequence plus His6-FLAG-tag ) by site-directed mutagenesis of CTAATGAGGAAATATCAGTGACTCGAGAATGGTGGGACA and TGTCCCACCATTCTCGAGTCACTGATATTTCCTCATTAG with primers to generate pME-Puro-sHF-LIPA-TGA-GPI. The SECIS sequence of the human SELT gene was amplified using the primer set TCATCCCTAAGCGGCCGCCACCCTATCAGCACTGAAAAC and GACTAGTCTAGCGGCCGCGCCAGCACTGCATGCACTGAAACACTATCTTG, and the stop codon (UAA) of the LIPA-TGA-GPI sequence was inserted after the NotI site by infusion cloning. The sHF-LIPA-GPI and sHF-LIPA-Sec...

Embodiment 2

[0041] Construction of a system for removing the PIGK gene: First, the PIGK gene was knocked into HEK293 cells using the CRISPR / Cas9 system. BbsI cuts the vector pX330-EGFP(25). The PIGK-KO target sequence set caccGCTCTTGTCCTTCGGCAGCGTGG and aaacCCACGCTGCCGAAGGACAAGAGC were ligated into digested pX330-EGFP to generate pX330-EGFP-PIGK-KO. After transfection, cells with EGFP were sorted with a cell sorter S3 (Bio-Rad Laboratories). The collected cells were cultured for 7 days or more and subjected to limiting dilution to obtain clonal KO cells. The clone without WT allele was selected, and the DNA sequence was analyzed by sequencing. Then, the PIGK expression construct was inserted into the genome of PIGK-KO cells. The vector was pPB-FRT-PGKp-PurodTK, which contained a PGK promoter, a poly Cloning site, a bovine growth hormone polyadenylation signal, an SV40 promoter and puroΔTK flanked by PB terminal repeats and Flippase recognition target (FRT) ends. PIGK was amplified and ...

Embodiment 3

[0049] Validation of elimination of GPI-form recombinant proteins by knocking out the PIGK gene: Even though we obtained cell lines highly expressing recombinant proteins using the GPS system, some recombinant proteins were expressed on the cell surface in the form of GPI-AP. When administered as a drug, the small fraction of GPI-anchored forms may affect protein properties such as activity and immunogenicity. We therefore next attempted to eliminate the GPI-anchored form from cells.

[0050] For this purpose, we established cell lines that can regulate the expression of the GPI biosynthesis gene PIGK. Deletion of endogenous PIGK from HEK293 cells resulted in loss of GPI-AP expression (attached image 3 A). Then, a cassette containing the PIGK gene fragment and the puroΔTK gene flanked by FRT sites and PB transposon recognition sites was reinserted into the genome to restore GPI-AP expression in the rescued cells. In this system, PIGK can be excluded by FLP recombinase or P...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression system utilizing GPI anchor protein containing selenocysteine and a cell for highly expressing recombinant protein. A gene for coding selenoprotein is inserted into a sequence SECIS in Sec of a 3' end untranslated region UTR; pME-sHF-specific protein-Sec-GPI-SECIS is prepared; a SECIS sequence of a human SELT gene is amplified, and after a specific protein gene sequence, a codon TGA, a GPI modified sequence of human-derived CD59 protein and a termination codon TAA are inserted into a NotI site, the expression system utilizing GPI anchor protein containingselenocysteine is constructed. The system can express soluble recombinant protein to the surface of a cell membrane, protein is prevented from being secreted to a culture medium, the expression quantity of recombinant protein is analyzed by detecting the quantity of protein on the surface of the cell membrane, and the difficulty of detecting and screening high-expression cells is greatly simplified. Compared with other screening systems, the system expresses recombinant soluble protein to the surface of the cell membrane, flow sorting is utilized, and screening is convenient and efficient.

Description

technical field [0001] The invention belongs to the technical field, and in particular relates to a GPI-anchored protein expression system containing selenocysteine ​​and a cell highly expressing the recombinant protein. Background technique [0002] Production of recombinant proteins using mammalian cells has received increasing attention as they are increasingly used in biopharmaceuticals and clinical research. Mammalian cell lines, such as Chinese hamster ovary cells (CHO), baby hamster kidney cells, mouse myeloma cells, and human embryonic kidney 293 (HEK293) cells, have been investigated due to their proper protein folding, assembly, and post-translational modification capabilities. Widely used in the production of recombinant proteins. In recent years, the demand for pharmaceutical proteins has increased year by year. At present, the increase in productivity is mainly through the improvement of gene transfection efficiency and gene amplification rate, host cell engine...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/85C12N15/62C12N15/54C12N15/11C12N5/10
CPCC12N15/85C12N9/20C12N9/2465C12N9/1096C12N5/0603C12N5/0686C12Y301/01003C12Y302/01022C12N2800/107C07K2319/035C07K2319/02C07K2319/21C12N2510/02
Inventor 藤田盛久柳艺石
Owner JIANGNAN UNIV