Expression vector of membrane protein AmtB and expression and purification method of membrane protein AmtB

An expression vector, expression and purification technology, applied in the field of protein production, can solve the problems of difficult protein expression and resistance to drug-resistant bacteria, and achieve the effect of improving transcription and translation efficiency

Pending Publication Date: 2021-07-16
NANJING UNIV OF SCI & TECH
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] As a commonly used expression host, Escherichia coli has always been the first choice for protein expression. However, even E. coli proteins are difficult to express in large quantities in E. coli
At present, due to the abuse of antibiotics, it will be impossible to fight against drug-resistant bacteria in the next 50 years

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Expression vector of membrane protein AmtB and expression and purification method of membrane protein AmtB
  • Expression vector of membrane protein AmtB and expression and purification method of membrane protein AmtB
  • Expression vector of membrane protein AmtB and expression and purification method of membrane protein AmtB

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] The gene cloning of embodiment 1AmtB

[0033] 1. Cloning of AmtB

[0034] a) According to the codon usage frequency of Escherichia coli under the Kazusa online database (http: / / www.kazusa.or.jp / codon / ), design a new AmtB coding sequence (SEQ ID NO.1) , and synthesized. Then amplified by PCR method. The PCR reaction system configuration is shown in Table 1.

[0035] Table 1 PCR reaction system preparation table

[0036]

[0037]

[0038] PCR results such as figure 1 shown.

[0039] b) Recover the target DNA, digest the target fragment and pLy077 plasmid with NcoI and BamHI, and then perform agarose gel electrophoresis to recover the digested product; add the recovered target fragment and pLy077 plasmid fragment at a molar ratio of 5:1 In a small centrifuge tube, add T4 ligase and ligate overnight at 16°C.

[0040] c) 20 μL of the above ligation product was transformed into 80 μL of DH5α competent cells by heat shock method at 42°C, added with 700 μL of LLB m...

Embodiment 2

[0043] The expression of embodiment 2AmtB

[0044] Inducible Expression of Fusion Protein AmtB-Superfolded Fluorescent Protein

[0045] The correctly identified pLy077-AmtB plasmid was transferred to Escherichia coli expression host B121 (DE3) and C43 (DE3), and was spread on the bacterium colony that contained 0.1mM isopropylthiogalactopyranoside (IPTG) and obtained stable transformation; By for Detection of colony fluorescence, Figure 5 In order to transform the colony fluorescence image on the agar plate, whether the colony contains a recombinant plasmid can be known from the presence or absence of fluorescence, and the colony containing the recombinant plasmid shows fluorescence, and it can be seen that a large number of mutants expressing the target protein have been obtained.

[0046]Inoculate a single colony into LB and TB liquid medium containing 100 μg / ml ampicillin, and culture overnight at 200 rpm at 37°C to obtain overnight bacteria. Inoculate the overnight bact...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an expression vector of a membrane protein AmtB and an expression and purification method of the membrane protein AmtB. The nucleotide sequence of the expression vector is shown as SEQ ID NO.2, and the expression vector comprises a phage T7 promoter; an escherichia coli ribosome binding site, which comprises an NcoI sequence CCATGG, an escherichia coli membrane protein AmtB sequence as shown in SEQ ID NO. 1, and a BamHI site GGATCC; a tobacco etch virus cysteine protease cleavage site GAGAACCTGTACTTCCAATCC; an NdeI enzyme cutting site CATATG; a super-folded Venus fluorescent protein coding sequence; an XhoI enzyme cutting site is CTCGAG; and 6 histidine sites and a termination codon TAG. According to the present invention, a fluorescent protein with molecular rigidity is used as a selection marker and an expression process indicator, and the fluorescent protein can be quickly folded due to a molecular level rigid structure, so as to help the nitrogen-terminal membrane protein AmtB stabilize the conformation. The expression vector constructed by the invention can realize mass expression of the membrane protein AmtB, and can be used for high-throughput screening of subsequent novel antibiotics.

Description

technical field [0001] The invention belongs to the technical field of protein production, and relates to an expression vector of ammonia channel protein (AmtB) and an expression purification method thereof. Background technique [0002] The cell membrane is the boundary between the inside and outside of the cell, and is responsible for the important functions of information transmission, energy transmission and material exchange, and is the most important organelle. The target of drug action is often located on the cell membrane. More than 50% of known drug targets are membrane proteins. Therefore, the study of membrane proteins is of great significance. [0003] However, due to the rare content of membrane proteins in their natural state and their multiple transmembrane structures, folding errors are prone to occur and their structures are complex. Therefore, the large-scale preparation of membrane proteins has always been a difficulty and hot spot. In China, there are ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/70C12N15/65C12N15/62C07K14/245
CPCC12N15/70C12N15/65C07K14/245C12N2800/22C07K2319/35C07K2319/60
Inventor周敏张苑桢卢颖洪
OwnerNANJING UNIV OF SCI & TECH