Mutant with thermal stability of gamma-glutamine methylamine synthetase and encoding gene, amino acid sequence and application of gamma-glutamine methylamine synthetase mutant

A glutamine methylamine and gene sequence technology, applied in the field of mutants of γ-glutamine methylamine synthetase, can solve problems such as easy inactivation and hindering synthetase, so as to reduce reaction cost, release ATP inhibition, and reduce production cycle effect

Active Publication Date: 2021-07-23
INNOBIO CORP LTD
View PDF6 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

One of the reasons hindering the efficiency of microbial enzymatic production of theanine is that γ-glutamine synthetase is easily inactivated

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Mutant with thermal stability of gamma-glutamine methylamine synthetase and encoding gene, amino acid sequence and application of gamma-glutamine methylamine synthetase mutant
  • Mutant with thermal stability of gamma-glutamine methylamine synthetase and encoding gene, amino acid sequence and application of gamma-glutamine methylamine synthetase mutant
  • Mutant with thermal stability of gamma-glutamine methylamine synthetase and encoding gene, amino acid sequence and application of gamma-glutamine methylamine synthetase mutant

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0044] Construction of embodiment 1 mutant

[0045] The theanine synthase gene gmas sequence derived from Methylovorus mays, codon-optimized sequence is SEQ ID NO.1, connected into plasmid pET28(a), and transformed into E.coliBL21 to obtain the original strain E. .coliBL21-pET28(a)-gmas named WT.

[0046] The method for obtaining gmas DBM of gamma-glutamine methylamine synthetase mutant, comprises the steps:

[0047] 1. Follow the QuickMutation TM Gene random mutation kit design primers and random mutation, the primer sequence is:

[0048] random-F: GATATACATATGAAGAGCCTGGAAG; SEQ ID NO.4;

[0049] random-R: cccaagcttGTAGAATTGAACATAGCGG; SEQ ID NO.5;

[0050] 2. Random mutation PCR reaction

[0051] The random mutation PCR reaction refers to the following table to set up the random mutation PCR reaction system:

[0052] Table 1

[0053] Reagent final concentration volume Double distilled water or MilliQ water - 12.2μL RandomMut buffer(10×) 1× ...

Embodiment 2

[0063] Theanine was prepared by biotransformation using mutant gmas DBM wet bacteria as biocatalyst and sodium glutamate and ethylamine hydrochloride as substrates. The catalytic system is 10L, and the catalytic system comprises 400mM sodium glutamate, 440mM ethylamine, 160mM magnesium chloride, 2mM ATP, 160mM sodium hexametaphosphate and 60g / L gmas DBM wet thallus and 40g / LPPK wet thallus. The reaction system was reacted at 45°C in an aqueous solution with pH=7. After the reaction, the cells were removed by centrifugation, and the samples were filtered through a 0.22 μm membrane to detect the production of theanine by HPLC. The maximum output of theanine is 345mM, which is 60.1g / L, the reaction time is 16 hours, and the production intensity is 3.76g / L / h, which is 2.0 times that of the original bacteria.

Embodiment 3

[0064] The influence of embodiment 3 temperature on enzyme property

[0065] Temperature can change the catalytic reaction speed of the enzyme, and can also lead to the reduction or inactivation of the enzyme protein activity. Simultaneously determine the optimal reaction temperature of unmutated WT and mutant gmas DBM. Respectively placed at 30, 35, 40, 45, 50 ° C for 60 minutes. In a PBS solution with pH=7, the reaction system contained 50 mM sodium glutamate, 55 mM ethylamine, 40 mM magnesium chloride and 30 mM ATP and 15 g / L gmas cells. The change of theanine in the reaction solution was regularly measured by HPLC, and the enzyme activity value of WT measured at 35°C was taken as 100%, and the relative enzyme activity at other temperatures was calculated. Experimental results such as figure 1 It was shown that the optimal temperature of WT was 35°C, while that of gmasDBM was 45-50°C.

[0066] The non-mutated WT and mutant gmas DBM were incubated at 35 and 45°C, and the...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a mutant with thermal stability of gamma-glutamine methylamine synthetase, an encoding gene and amino acid and application of the mutant to production of theanine. Specifically, the mutant of the gamma-glutamine methylamine synthetase is obtained through a genetic engineering method. The mutant is long in half-life period; while the thermal stability of the mutant of the gamma-glutamine methylamine synthetase is improved, the optimum temperature of the enzyme is increased by 10-15 DEG C, the mutant can play a very good catalytic effect without being in a buffer salt solution, and meanwhile, the theanine is efficiently synthesized by utilizing the mutant through a method of coupling polyphosphate kinase; and according to the method, adenosine triphosphate (ATP) regeneration can be implemented while the theanine is synthesize by catalysis, and an effective way is provided for enzymatic industrial production of the theanine.

Description

technical field [0001] The present invention relates to an enzyme mutant, in particular to a thermostable γ-glutamine methylamine synthetase mutant, its coding gene, amino acid and its application in the production of theanine. Background technique [0002] L-theanine (L-theanine) belongs to amide compounds and is the most abundant free amino acid in tea, accounting for more than 50% of the total free amino acids. Theanine is the main component of tea aroma and taste, and its content plays a key role in the flavor and quality of tea. The property of theanine is relatively stable. The content of theanine will not change if the theanine solution is boiled for 5 minutes, or theanine is dissolved in a pH 3.0 solution and stored at 25°C for 12 months. Therefore, in the usual food processing and sterilization process, the properties of theanine will not change, and no toxicity was found in the toxicity test. [0003] L-theanine, as a safe functional active factor integrating mul...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N9/00C12N15/52C12P13/04
CPCC12N9/93C12P13/04C12Y603/04012
Inventor齐佳琨范超刘军洪皓刘明吴文忠
OwnerINNOBIO CORP LTD