Method for improving erythromycin yield by guiding n-propyl alcohol feeding through genome model

A technology of n-propanol and erythromycin, which is applied in the field of systems biology, can solve the problems of low utilization rate of n-propanol, high medium requirements, low yield, etc., achieve good accuracy and prediction ability, increase yield, Yield improvement effect

Pending Publication Date: 2021-07-27
EAST CHINA UNIV OF SCI & TECH +1
View PDF2 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0006] In summary, although erythromycin biological fermentation has made some progress, there are still problems such as high requirements on the medium (requiring a high-cost composite medium), low yield, and low utilization of n-propanol.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for improving erythromycin yield by guiding n-propyl alcohol feeding through genome model
  • Method for improving erythromycin yield by guiding n-propyl alcohol feeding through genome model
  • Method for improving erythromycin yield by guiding n-propyl alcohol feeding through genome model

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0041] Example 1. Construction of Genome-wide Metabolic Network Model

[0042] The construction of the genome-wide metabolic network model of Saccharopolyspora rubrum engineering bacteria includes genome-wide annotation, manual refinement of the draft metabolic network model, transformation of the metabolic network model into a mathematical model, and model verification and correction.

[0043] (1) Whole genome annotation

[0044] Annotate and check the genome sequence of Saccharopolyspora rubrum genetically engineered bacteria measured by Huada University. The annotation of genome function can be carried out through various databases (such as KEGG, NCBI, Enzyme, UniprotKB, SwissProt, IMG, and BioCyc, etc.). The database information used is shown in Table 1.

[0045] Table 1

[0046]

[0047]

[0048] (2) Manual refinement of the sketch of the metabolic network model

[0049] First, it is necessary to check the material and charge balance of reactions and metabolites ...

Embodiment 2

[0072] Example 2, Preparation of sucC Knockout Genetic Engineering Bacteria

[0073] The industrial strain S. erythraea E3 strain (obtained from Shanghai Guojia Biochemical Engineering Technology Research Center Co., Ltd.) was used as the starting strain to prepare the genetically engineered bacteria with succinyl-CoA synthetase gene (sucC) knockout. The sucC gene was knocked out by insertional inactivation, and primers were designed during the insertional inactivation process to amplify a fragment of 1021 bp in length from 196 bp to 1216 bp behind the start codon of the sucC gene. The primer sequences are as follows:

[0074] Upstream primers:

[0075] CCCAAGCTTGGGATGAGGCCAAGACGAA (SEQ ID NO: 1);

[0076] Downstream primers:

[0077] GAAGATCTTCGCCCTGGACGATGACCTTG (SEQ ID NO: 2).

[0078] The genome of the S. erythraea E3 strain was used as a template, and the above primers were used to amplify to obtain the target fragment, which was 1021 bp in length. The fragment was i...

Embodiment 3

[0080] Example 3. Basic culture of S.erythraea E3-△sucC strain

[0081] Plate Seed Medium:

[0082] Starch 10.0g / L, corn steep liquor 13.0g / L, sodium chloride 3.0g / L, ammonium sulfate 3.0g / L, agar 20.0g / L, calcium carbonate 3.0g / L.

[0083] Shake Flask Seed Medium:

[0084] Starch 40.0g / L, sodium chloride 4.0g / L, calcium carbonate 1.5g / L, peptone 20.0g / L, glucose 10.0g / L, magnesium sulfate 0.25g / L, magnesium sulfate heptahydrate 0.2g / L.

[0085] Fermentation medium (using synthetic medium):

[0086] Glucose 22.0g / L, magnesium sulfate heptahydrate 1.0g / L, potassium dihydrogen phosphate 0.64g / L, dipotassium hydrogen phosphate 1.28g / L, alanine 0.86g / L, arginine 0.68g / L, semi Cystine 0.78g / L, Serine 0.73g / L, Trisodium Citrate 2.28g / L, Cobalt Chloride 0.009g / L, Sodium Borate 0.006g / L, Ferric Chloride 0.0068g / L, Copper Chloride 0.00027g / L, ammonium molybdate 0.00027g / L.

[0087]1. Plate seed culture

[0088] Prepare the flat seed medium according to the required amount, adjust...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for improving erythromycin yield by guiding normal propyl alcohol feeding through a genome model, which comprises the following steps: in the fermentation process of saccharopolyspora erythraea genetically engineered bacteria, feeding ammonium sulfate and n-propyl alcohol 50-70 hours after the start of fermentation, wherein the n-propyl alcohol feeding rate is obtained by constructing a saccharopolyspora erythraea whole genome metabolic network model and analyzing the model. The whole genome metabolic network model of the saccharopolyspora erythraea genetically engineered bacteria is constructed to carry out systematic cell growth simulation, and a strategy is provided for increasing the yield of erythromycin. Under the guidance of a whole genome metabolic network model, the existing fermentation process of saccharopolyspora erythraea genetically engineered bacteria is optimized, and the yield of erythromycin is increased by regulating and controlling the supplementation rate of n-propanol.

Description

technical field [0001] The application relates to the technical field of systems biology, in particular to the optimization of the fermentation process of Saccharopolyspora rubrum genetically engineered bacteria under the guidance of a whole-genome metabolic network model. Background technique [0002] Saccharopolyspora erythraea is a Gram-positive filamentous actinomycete. The most important feature of this bacterium is that it can produce an antibiotic with significant medical efficacy: erythromycin. Erythromycin is an important broad-spectrum 14-membered ring macrolide antibiotic commonly used in the treatment of many diseases caused by Gram-positive pathogens. [0003] At present, in industrial production, erythromycin is mainly produced by means of fermentation. Similar to the production of antibiotics by secondary metabolic reactions in other actinomycetes, the synthetic process of erythromycin is complex and largely affected by the composition of the medium and cultu...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12P19/62C12N1/20C12R1/01
CPCC12P19/62C12N1/20
Inventor黄明志陆举柯翔储炬
OwnerEAST CHINA UNIV OF SCI & TECH