4,6-alpha-glucosyltransferase and application thereof in improving quality of steamed buns

A glucose-based and transferase technology, applied in the field of genetic engineering, can solve the problems of low molecular weight of modified dextrin, increase the shelf life of steamed bread, and high molecular weight, and achieve the effects of high raw material utilization rate, improved texture and taste, and simple operation.

Active Publication Date: 2021-07-30
JIANGNAN UNIV
View PDF3 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0007] Aiming at the low molecular weight of the modified dextrin prepared by the current enzymatic method and unable to meet the needs of high molecular weight modified dextrin in some fields, the present invention reports A technology for preparing modified dextrin by enzymatic method can be used to obtain modified dextrin product with high molecular weight, low calorie and difficult to be digested by human body. This product can be used as a new type of prebiotic; it has better long-lasting Water-based and satiety can be widely used in the food industry. Adding this modified dextrin to steamed bread can delay starch aging and increase the shelf life of steamed bread

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • 4,6-alpha-glucosyltransferase and application thereof in improving quality of steamed buns
  • 4,6-alpha-glucosyltransferase and application thereof in improving quality of steamed buns
  • 4,6-alpha-glucosyltransferase and application thereof in improving quality of steamed buns

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0042] Example 1: Heterologous expression of 4,6-α-glucosyltransferase (Gtf16) derived from Lactobacillus fermentum

[0043] Using the plasmid with the full-length gtf16 gene (nucleotide sequence shown in SEQ ID NO.2) as a template, design primers, obtain the target gene 4,6-α-glucosyltransferase gene (gtf16) after PCR, and construct Recombinant plasmid pBSMuL3-gtf16. Specific steps are as follows:

[0044] PCR primers:

[0045] D-F: CCATGGGGAAACTGCTGAAAACCCTG (SEQ ID NO. 3);

[0046] D-R: TTCGAATAGTAGAAGTTATAAGCGTATTATT (SEQ ID NO. 4).

[0047]The PCR system is: 20 μM primers D-F and D-R 0.5 μL each, dNTP Mix 4 μL, 5xPS Buffer 10 μL, 2.5 U / μL PrimeStar polymerase 0.5 μL, template 0.5 μL, add double distilled water to make up 50 μL.

[0048] PCR conditions: pre-denaturation at 94°C for 4min; denaturation at 98°C for 10s, annealing at 55°C for 10s, extension at 72°C for 3.5min, 30 cycles.

[0049] The PCR product was gel-recovered, ligated with the cloning vector pMD18T ov...

Embodiment 2

[0051] Embodiment 2: Shake flask fermentation produces enzyme

[0052] The recombinant strain obtained in Example 1 was inoculated in LB medium, and after culturing at 37°C for 8 hours, it was transferred to 50mL TB fermentation medium with a 5% inoculum amount, and then expanded and cultivated at 37°C and 200rpm at a constant temperature for 1 -2h, at cell OD 600 When the growth rate reaches 0.5-1.0, isopropyl-β-D-thiogalactopyranoside (IPTG) (final concentration: 0.08mmol / L) is added, and finally placed at 25°C and 200rpm for 24h shake flask fermentation. After the fermentation is finished, the fermented liquid is crushed by high-pressure homogenization and then centrifuged, and the supernatant is the 4,6-α-glucosyltransferase enzyme liquid produced by the recombinant bacteria.

Embodiment 3

[0053] Example 3: 4,6-α-glucosyltransferase enzyme activity assay

[0054] 1. Enzyme activity assay

[0055] The total enzyme activity of Gtf16 obtained from fermentation in Example 3 was determined by the iodine method. Iodine reagent: Dissolve 2.6gI with appropriate distilled water 2 Dissolve with 26g KI, transfer it to a 100mL volumetric flask, store at 4°C, and dilute with distilled water at a ratio of 1:260 before use.

[0056] During the reaction, at 40°C, with amylose (0.125%, w / v, i.e. 1.25g / L) as the substrate, in 0.2mol / LNa 2 HPO 4 Enzyme activity was measured in -0.1mol / L citric acid buffer (pH 5.0). During the reaction, take 200 μL of the substrate in a 1.5 mL centrifuge tube and incubate at 40° C. for 10 min. Add 200 μl of Gtf16 enzyme solution and react at 40°C for 10 minutes. After the reaction, take 200 μl of the reaction solution and add it to 3800 μL of iodine chromogenic solution for 5 minutes. Measure the absorbance at 660 nm with a spectrophotometer. ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
thicknessaaaaaaaaaa
Login to View More

Abstract

The invention discloses 4,6-alpha-glucosyltransferase and application of the 4,6-alpha-glucosyltransferase in improving the quality of steamed buns, and belongs to the technical field of genetic engineering. The 4,6-alpha-glucosyltransferase is prepared from 4,6-alpha-glucosyltransferase (gtf16) from lactobacillus fermentum in a heterologous expression mode, the obtained 4,6-alpha-glucosyltransferase is applied to preparation of the modified dextrin, and the prepared modified dextrin has the advantages of being low in calorie, large in molecular weight, resistant to digestive enzyme hydrolysis and the like. The method has the advantages of low energy consumption, short time, high conversion efficiency and few byproducts in the product, and has important significance for industrial preparation of high-molecular-weight modified dextrin. When the modified dextrin is added into the steamed buns, starch aging can be delayed, and the shelf life of the steamed buns can be prolonged.

Description

technical field [0001] The invention relates to 4,6-alpha-glucosyltransferase and its application in improving the quality of steamed bread, and belongs to the technical field of genetic engineering. Background technique [0002] In recent years, with the improvement of people's material living standards, people's demand for a healthy diet has also increased. Low-fat and low-sugar have become people's new standards. Therefore, this type of functional carbohydrates that meet the standards has become a healthy food in the 21st century. A bellwether of development. [0003] Resistant dextrin is a glucose polymer containing α-1,4, α-1,6, α-1,3, α-1,2 linkages, due to its richness in slow-digesting α-1,6 linkages and resistance to digestion The α-1,3, α-1,2 bonds in the human body are not easily decomposed by digestive enzymes in the human body, and are not easily digested and absorbed by the small intestine, so they can promote the proliferation of intestinal probiotics; at the...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12P19/04C12P19/18C12P19/14A23L7/104A23L29/30A23L7/109A23C9/13A23C19/00A23C9/156A23L2/52A23L13/40A23G3/42A23G3/36A23G9/34A23L3/3562A21D2/18
CPCC12P19/04C12P19/18C12P19/14A23L7/104A23L29/35A23L7/109A23C9/1307A23C19/00A23C9/156A23L2/52A23L13/426A23G3/42A23G3/364A23G9/34A23L3/3562A21D2/181A23V2002/00A23V2200/14A23V2200/332A23V2200/328A23V2250/5114
Inventor陈晟吴敬盛露菲杨卫康
OwnerJIANGNAN UNIV